1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
n200080 [17]
4 years ago
7

using the vocabulary of osmosis, explain what may happen to the vegetation along the side of a road when excessive amounts of sa

lt are used during the winter
Biology
1 answer:
Ber [7]4 years ago
6 0

The plants will severely dessicate and show the symptoms of burns.

Explanation:

  • Osmosis is defined as the movement of Solvent molecule  from a Hypotonic solution to Hypertonic solution through a Semi-permeable membrane.
  • During winters, the humidity is less in the atmosphere and rate of transpiration is comparatively higher, Thus, the plant loses a significant quantity of water.
  • Presence of Salt around the cells creates a hypertonic environment around it and results  in ex osmosis of water . Hence the plant severely desiccates and the tissues might get damaged resembling the symptoms of burns.
You might be interested in
All you need is in the photo ​
Vinvika [58]

Answer:

i want to ive in habitat a

Explanation:

mark me brainliest bc im smart and helped aloyt

6 0
3 years ago
Read 2 more answers
Do the properties of adhesion, cohesion, and surface tension behave different in salt water vs fresh water
Elanso [62]

Answer:

The water has a dipole that causes it to act like a magnet, attracting other water molecules to it. Adhesion is the attractive forces that cause water to "stick" to a surface other than its own. ... The salt water has a much lower cohesion than plain water so it's attractive forces are less than plain water.

8 0
3 years ago
What is the term for sedimentary rock that is composed of material evaporated from seawater
Maurinko [17]
B. Chemical is the answer
8 0
3 years ago
Read 2 more answers
What is the meaning of mitochondria?​ and what are the functions?
Nimfa-mama [501]

Explanation:

mitochondria is a double membrane bound cell organelle,oval or cylindrical in shape.

<h3 /><h3>function</h3>
  • regulate calcium ions in cells
  • formation of yolk
  • help in synthesis of photosynthetic pigments
  • can synthesize store and distribute energy in the form of ATP whenever required
4 0
2 years ago
Read 2 more answers
While caring for the neonate of a human immunodeficiency virus-positive mother, the nurse prepares to administer a prescribed vi
7nadin3 [17]
The first action that the nurse should take is to BATHE THE NEONATE. 
Typically, new born are bathe within two to four hours after their birth when their temperature have stabilized. But early or immediate bathing is recommended for the babies of HIV positive mothers in order to reduce blood exposure.
3 0
3 years ago
Other questions:
  • What is the impact of a nonsence mutation?
    8·1 answer
  • Which action would control bleeding through the use of pressure points?
    5·1 answer
  • The students are studying for an exam in pharmacology. They know several local anesthetics have been covered along with other fo
    13·1 answer
  • What is attached to rough ER
    12·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • What is the basic unit of structure and function in living things?
    7·2 answers
  • Organic molecules usually contain
    8·1 answer
  • Differences between stamen and pistil​
    14·1 answer
  • 100 PTSSS PLEASEE HELPPPPPPP I NEED THIS PLSS IVE BEEN TRYING FOR 30 MINNSS
    13·2 answers
  • Food must be broken down into________
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!