Answer:
The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.
Explanation:
Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.
If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:
<u>Exercise 1:</u>
- DNA ATACGAAATCGCGATCGCGGCGATTCGG
- mRNA UAUGCUUUAGCGCUAGCGCCGCUAAGCC
- CODON UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
- AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
- Amino acid Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser
<u>Exercise 2: </u>
- DNA TTTACGGCCATCAGGCAATACTGG
- mRNA AAAUGCCGGUAGUCCGUUAUGACC
- CODON AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
- AntiCODON UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
- Amino acid Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
Cell specialization allows new cells to develop into a range of different tissues, all of which work together to make living organisms function as a whole. The process of cell specialization exactly how cells develop into their diverse forms is complex.
Phosphate groups of the nucleotides in the diagram are marked with W.
Option C.
<h3><u>Explanation:</u></h3>
DNA is a macro molecule which is formed of polymerization of deoxyribonucleotides. Four types of deoxyribonucleotides are present which are adenosine, guanosine, thymidine and cytosine triphosphate. These nucleotides are polymerized based on the genetic setup.
The phosphate groups attached with the sugar molecule are actually polymerized with the o glycosidic bond. That's marked with the letter W. These phosphate molecules are attached with the sugar molecules which actually are attached with the nitrogen bases. They in total forms a nucleotide, hence the whole DNA. X in the diagram are nitrogen bases and the Y are the hydrogen bonds between the complementary nitrogen bases
Answer:
last answer. Breaks down sugar before respiration can begin. Glycolysis breaks down glucose. glucose=sugar
Carbon dioxide can be transported through the blood via three methods. It is dissolved directly in the blood, bound to plasma proteins or hemoglobin, or converted into bicarbonate.
The majority of carbon dioxide is transported as part of the bicarbonate system. Carbon dioxide diffuses into red blood cells. Inside, carbonic anhydrase converts carbon dioxide into carbonic acid (H2CO3), which is subsequently hydrolyzed into bicarbonate (HCO3−) and H+. The H+ ion binds to hemoglobin in red blood cells, and bicarbonate is transported out of the red blood cells in exchange for a chloride ion. This is called the chloride shift.
Bicarbonate leaves the red blood cells and enters the blood plasma. In the lungs, bicarbonate is transported back into the red blood cells in exchange for chloride. The H+ dissociates from hemoglobin and combines with bicarbonate to form carbonic acid with the help of carbonic anhydrase, which further catalyzes the reaction to convert carbonic acid back into carbon dioxide and water. The carbon dioxide is then expelled from the lungs.
