Polysaccharide digestion and glycogen breakdown involve sequential cleavage from ________ ends of glucose polymers.

1 answer:

5 0

Sequential cleavage from the non-reducing terminals of glucose molecules is required for both glycogen degradation and polysaccharides hydrolysis.

Why non-reducing end is selected for digestion?

A polysaccharide's non-reducing end is the one where an anomeric carbon participates in the glycosidic connection. The elimination of carbohydrate remnants one at a time out from the non-reducing terminal occurs during glycogenolysis and polysaccharides hydrolysis.

For example, several enzymes are involved in glycogenolysis in the liver and muscle.

An example of such an enzyme is glycogen phosphorylase, which catalyzes the successive dissociation of the alpha 1->4 glycosidic bond that connects two glucose molecules at a non-reducing terminal of glycogen. The last glucose residue is eliminated as alpha-D-glucose 1-phosphate.

That is why non-reducing end of glucose is chosen for digestion or breakdown of the carbohydrate polymer.

Learn more about non-reducing here:

brainly.com/question/1832596

#SPJ4

You might be interested in

What do you think the term gene expression means?

Ymorist [56]

Answer:

The term gene expression means the process by which the information encoded in our DNA is used to synthesize a functional product, such as a protein molecule or other cell structures.

Explanation:

6 0

2 years ago

Mechanism of double fertilization

Sunny_sXe [5.5K]

One sperm fertilizes the egg cell forming a diploid zygote, the other sperm fuses with the two polar nuclei forming a triploid cell that develops into endosperm

4 0

2 years ago

Which statements about the Hubble Space Telescope are true?

ankoles [38]

<h2 /><h2> $Answer-$ </h2>

The Hubble Space Telescope (often referred to as HST or Hubble) is a space telescope that was launched into low Earth orbit in 1990 and remains in operation. It was not the first space telescope, but it is one of the largest and most versatile, renowned both as a vital research tool and as a public relations boon for astronomy. The Hubble telescope is named after astronomer Edwin Hubble and is one of NASA's Great Observatories, along with the Compton Gamma Ray Observatory (1991–2000), the Chandra X-ray Observatory (1999–present), and the Spitzer Space Telescope (2003–2020). The Space Telescope Science Institute (STScI) selects Hubble's targets and processes the resulting data, while the Goddard Space Flight Center (GSFC) controls the spacecraft.

3 0

2 years ago

What is the mRNA in TACCGGATGCCAGATCAAATC?

Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0

2 years ago

Completa las siguientes hebras de ADN

den301095 [7]

Answer:

yes.

Explanation:

hdjsbsjwhsjbsjwbsjsjs

6 0

3 years ago