1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ghella [55]
1 year ago
13

Polysaccharide digestion and glycogen breakdown involve sequential cleavage from ________ ends of glucose polymers.

Biology
1 answer:
Alex787 [66]1 year ago
5 0

Sequential cleavage from the non-reducing terminals of glucose molecules is required for both glycogen degradation and polysaccharides hydrolysis.

Why non-reducing end is selected for digestion?

A polysaccharide's non-reducing end is the one where an anomeric carbon participates in the glycosidic connection. The elimination of carbohydrate remnants one at a time out from the non-reducing terminal occurs during glycogenolysis and polysaccharides hydrolysis.

  • For example, several enzymes are involved in glycogenolysis in the liver and muscle.
  • An example of such an enzyme is glycogen phosphorylase, which catalyzes the successive dissociation of the alpha 1->4 glycosidic bond that connects two glucose molecules at a non-reducing terminal of glycogen. The last glucose residue is eliminated as alpha-D-glucose 1-phosphate.

That is why non-reducing end of glucose is chosen for digestion or breakdown of the carbohydrate polymer.

Learn more about non-reducing here:

brainly.com/question/1832596

#SPJ4

You might be interested in
What do you think the term gene expression means?​
Ymorist [56]

Answer:

The term gene expression means the process by which the information encoded in our DNA is used to synthesize a functional product, such as a protein molecule or other cell structures.

Explanation:

6 0
2 years ago
Mechanism of double fertilization
Sunny_sXe [5.5K]
One sperm fertilizes the egg cell forming a diploid zygote, the other sperm fuses with the two polar nuclei forming a triploid cell that develops into endosperm 

4 0
2 years ago
Which statements about the Hubble Space Telescope are true?
ankoles [38]
<h2 /><h2>Answer-</h2>

The Hubble Space Telescope (often referred to as HST or Hubble) is a space telescope that was launched into low Earth orbit in 1990 and remains in operation. It was not the first space telescope, but it is one of the largest and most versatile, renowned both as a vital research tool and as a public relations boon for astronomy. The Hubble telescope is named after astronomer Edwin Hubble and is one of NASA's Great Observatories, along with the Compton Gamma Ray Observatory (1991–2000), the Chandra X-ray Observatory (1999–present), and the Spitzer Space Telescope (2003–2020). The Space Telescope Science Institute (STScI) selects Hubble's targets and processes the resulting data, while the Goddard Space Flight Center (GSFC) controls the spacecraft.

3 0
2 years ago
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
2 years ago
Completa las siguientes hebras de ADN
den301095 [7]

Answer:

yes.

Explanation:

hdjsbsjwhsjbsjwbsjsjs

6 0
3 years ago
Other questions:
  • If a wave has a wavelength of 1 centimeter, it must be a(n)
    11·2 answers
  • True or False. Sound first enters the ear, then passes through the eardrum into the ear, and then passes to the ear where the so
    7·1 answer
  • The final stage of general adaptation theory is known as
    15·1 answer
  • I need help ASAP
    5·1 answer
  • What is the relationship between the greenhouse effect and global warming
    7·2 answers
  • Plants are used for _____.
    11·1 answer
  • Digitized information can be used by computers. Please select the best answer from the choices provided T F
    15·2 answers
  • Fertilizer and cell difference ​
    8·1 answer
  • Explain the lifecycle of mosquito in short​
    11·1 answer
  • I need help ); anyone please
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!