1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Irina-Kira [14]
2 years ago
15

The symbols +,- , and 0 are to be used to show the results of interactions between individuals and groups of individuals. The sy

mbol + denotes a positive interaction, - denotes a negative interaction, and 0 denotes where individuals are not affected by interacting. The first symbol refers to the first organism mentioned. What interactions exist between mycorrhizae and evergreen tree roots? A. +/+
B. +/ 0 C. +/- D. 0 / 0
Biology
1 answer:
Firlakuza [10]2 years ago
5 0

The symbols +, -, and 0 are used to show the results of interactions between individuals and groups of individuals. The symbol + denotes a positive interaction, - denotes a negative interaction, and 0 denotes interactions in which individuals are not affected. The first symbol refers to the first organism mentioned.

<h3>What is interaction?</h3>

A type of activity known as interaction takes place when two or more items have an impact on one another. In contrast to a one-way causal effect, the idea of a two-way effect is crucial to the concept of interaction. Interactivity and interconnection are closely related concepts; the latter deals with the interactions of interactions inside systems; combinations of numerous straightforward interactions might result in unexpected emergent phenomena.

In many sciences, interaction has numerous specialized meanings. A basic interaction in physics is the process by which elementary particles interact with one another. Depending on the interaction, it may also be referred to as a fundamental force. A physical field is frequently used to define an interaction, and gauge exchange serves as its mediator.

To learn more about interaction from the given link:

You might be interested in
Carbon-12 and Carbon-14 are isotopes; it means that
jok3333 [9.3K]
A :-) Isotopes are forms of the same element with equal numbers of protons but different numbers of neutrons. For example, both carbon-12 and carbon-14 have 6 protons. But carbon-12 has 6 neutrons while carbon-14 has 8 neutrons. By definition, carbon-12, carbon-13 and carbon-14 are all isotopes of the carbon.
8 0
3 years ago
What organism conducts photosynthesis?
svetlana [45]
I am making a educated guess and saying producers. Plants mostly.
5 0
4 years ago
Read 2 more answers
In roots, ____ increase the surface area through which water and minerals can diffuse.
Ilya [14]
The answer is <span>root hairs</span>
8 0
3 years ago
Which of the following terms is used to describe the act of cleaning up pollution at a site?
ale4655 [162]
Should be decontamination because you are removing the pollution that has been dispersed.
7 0
3 years ago
What is the answer of letter C
Anna11 [10]

Answer:

(a) A and D

(b) B

(c) A

Hope this helps

4 0
4 years ago
Read 2 more answers
Other questions:
  • What is a volcano that is erupting or has erupted in the last 100 years called
    12·2 answers
  • What are two ways carbon returns from animals into the water?
    8·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Examine the photograph of a prepared slide of the root cross section. Notice that the section is circular in outline since it wa
    10·1 answer
  • In humans, attached earlobes are recessive to free hanging earlobs. If two heterozygous free lobed parents mate, what is the cha
    12·1 answer
  • What is one of the two main causes for hunting-related incidents in pennsylvania?
    9·1 answer
  • The planet Mercury is closer to the sun than the planet Venus. However, temperatures on Venus are hotter than temperatures on Me
    14·1 answer
  • carbon dioxide concentration would be the highest in the a) vena cava b) pulmonary vein c) renal artery
    13·1 answer
  • Definition of thylakoid
    9·1 answer
  • Kendra is studying the energy pyramid shown. which statement is supported by the energy pyramid? the ecosystem can support fewer
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!