1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ipn [44]
4 years ago
15

Using a simple food chain what is the order or sequence of energy transfer? Sun, plant, mouse, snake, owl Sun, plant, snake, mou

se, owl Snake, mouse, owl, plant, Sun Owl, plant, Sun, mouse, snake
Biology
2 answers:
Ksenya-84 [330]4 years ago
7 0
Hey!

If you were using a simple food chain, the order or sequence of energy transfer would be Sun, plant, mouse, snake, owl. 

The sun and plant are always the first 2. The plant would be depicted as a Producer, next, comes the primary consumer. The primary consumer is a herbivore and/or omnivore. The mouse would fall under this category. Third comes the secondary consumer. The secondary consumer is carnivorous. It eats the primary consumer. The snake falls perfectly under this category. Last but not least we have another carnivorous consumer, and that would be the owl.


Hope this helps! (Don't forget Brainliest!)

Nutka1998 [239]4 years ago
4 0
Sun plant mouse snake owl
You might be interested in
Աɦɨċɦ stʀatɛɢʏ ɨs ռօt ɦɛaʟtɦʏ ʄօʀ sʊstaɨռaɮʟɛ քօsɨtɨʋɛ ʀɛʟatɨօռsɦɨք
Inessa [10]

Answer:

A.

Explanation:

3 0
3 years ago
The process where the cytoplasm divides is called? a anaphase b telophase c cytokinesis d prophase
Genrish500 [490]

Answer:

Hello There!!

Your answer is C. CYTOKINESIS!

Explanation:

What happens here?

CYTOKINESIS is the stage in cell division where the CYTOPLASM (or the cell in general) begins to DIVIDE to form 2 IDENTICAL DAUGHTER CELLS...

It is started during/ after the nuclear division phase called Anaphase!

I HOPE THIS HELPS WITH YOUR WORK!!

:D

4 0
3 years ago
"during what stage of fetal development does differentiation of cells begin"
horsena [70]
Embryo ,the differentiation of cells start here

7 0
3 years ago
How are external respiration and internal respiration co-dependent?
lana66690 [7]

External respiration takes place in the lungs, where oxygen enters the blood and carbon dioxide enters the alveolar air. Internal respiration takes place in metabolizing tissues, where oxygen diffuses from the blood and carbon dioxide diffuses from the cells.

<h3>What is respiration?</h3>

Respiration is recognized as the movement of oxygen from the outside environment to the cells within tissues, as well as the removal of carbon dioxide in the opposite direction.

External respiration takes place in the lungs, where oxygen enters the blood and carbon dioxide enters the alveolar air.

Internal respiration takes place in metabolizing tissues, where oxygen diffuses from the blood and carbon dioxide diffuses from the cells.

Thus, in this way, external respiration and internal respiration are co-dependent.

For more details regarding respiration, visit:

brainly.com/question/12605249

#SPJ1

4 0
2 years ago
Match the appropriate labels to their respective targets.
Leona [35]

Answer:

Hormonal stimulus \rightarrow testosterone production

Neural stimulus \rightarrow  epinephrine production

Hormonal stimulus \rightarrow  aldosterone production

Humoral stimulus \rightarrow  parathyroid hormone production

Explanation:

The correct matching for the given unmatched is given below

Hormonal stimulus \rightarrow testosterone production

Neural stimulus \rightarrow  epinephrine production

Hormonal stimulus \rightarrow  aldosterone production

Humoral stimulus \rightarrow  parathyroid hormone production

7 0
3 years ago
Other questions:
  • You decide to volunteer at a community garden and are assigned to tend six equally sized vegetable beds. Three of the beds conta
    6·1 answer
  • Abnormally reduced somatic growth (dwarfism) can be a consequence of decreased hormone secretion from the
    12·1 answer
  • The body of a patient with copd may use low blood oxygen as the factor to stimulate her to breathe, a condition called _________
    13·1 answer
  • 7. Darrin identifies a deposit of talus bear the side of a landform. He determines that the deposit was formed by SC.6.E.6.1
    11·1 answer
  • Part a - blue-light photoreceptors and phototropism complete the flowchart to identify the process by which blue-light photorece
    12·2 answers
  • Which type of organism helps to reduce
    14·2 answers
  • An apple falls off a tree onto the ground. Which of the following best describes what eventually happens to the material that ma
    14·1 answer
  • Original Strand: AAGTACGATCGATGCACATGCATGGCTACGC<br> Complementary Strand:
    6·1 answer
  • Which bestexplains why offspring created through sexual reproduction have
    7·2 answers
  • Which process produces 32-36 ATP molecules?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!