1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lozanna [386]
3 years ago
15

"during what stage of fetal development does differentiation of cells begin"

Biology
1 answer:
horsena [70]3 years ago
7 0
Embryo ,the differentiation of cells start here

You might be interested in
What role do the oceans play in the carbon cycle?
Vika [28.1K]

Answer:

They are a major absorber of carbon dioxide.

Explanation:

Plants present deep under the seas and algae over the Oceans and under it absorb huge amount of CO2 from our atmosphere.

hope it helps!

4 0
4 years ago
Nitrogenous waste excreted by an eagle
ANTONII [103]

Answer:

<h2>URIC ACID </h2>

Uric Acid Uric acid is a compound similar to purines found in nucleic acids. It is water insoluble and tends to form a white paste or powder; it is excreted by birds, insects, and reptiles.

3 0
3 years ago
2. What is needed from fermentation to restart glycolysis?​
Shalnov [3]
How cells extract energy from glucose in the absence of oxygen. In yeast, anaerobic reactions produce alcohol, while in your muscles, they form lactic acid.





Both processes can happen thanks to alternative glucose degradation pathways that occur when normal cellular respiration that uses oxygen (aerobic) is not possible, that is, when there is no oxygen available that acts as an acceptor at the end of the transport chain of electrons. These fermentation pathways include glycolysis with a few extra reactions at the end. In yeast, the extra reactions produce alcohol; in the muscles, lactic acid.
Fermentation is a widespread route, but it is not the only way to obtain energy from fuels anaerobically (in the absence of oxygen). Some living systems use a different inorganic molecule instead of
OR
2
OR
2
I mean
  start text, O, end text, start subscript, 2, end subscript, like sulfate, as the final acceptor in an electron transport chain. This process, called anaerobic cellular respiration, is performed by some bacteria and archaeas.
6 0
3 years ago
When plants wilt they're soft stems and leaves begin to drop what is going on inside the plant cells that causes the plant to dr
Nat2105 [25]
The cell membranes begin to come apart when there is insufficient water around the cells. The cytoplasm of the cells becomes more concentrated, which slowly poisons the cells. The cell walls become brittle as they dry out, and some of them collapse. The central vacuoles in the cells lose water and can no longer help support the cells.


The central vacuoles in the cells lose water and can no longer help support the cells
3 0
3 years ago
CAN SOMEONE HELP ME
Rom4ik [11]

Answer:

mulleran mimickery

Explanation:

5 0
3 years ago
Other questions:
  • Endorphins are released by the ______________.
    8·1 answer
  • Which of the following is an impact of an increase in motor vehicles in cities?
    5·2 answers
  • When the Daphne Major finches reach a point where the costs of a having beak larger than average size outweigh the benefits, bea
    15·1 answer
  • During a presentation about evolution a student claims that modern giraffes inherited their long necks from ancestral giraffes t
    10·2 answers
  • In your own words explain what the Continental Drift Theory states. Give two examples of evidence that support this theory
    5·1 answer
  • 45 / 10000 Word Limit Question 2 (b) The membranes of both B cells and the cancer cells are largely composed of phospholipids. E
    10·1 answer
  • Refer to the illustration above. The structure labeled D is a(n)
    11·1 answer
  • How does sweating help to cool and regulate body temperature? A) The increased salt concentration of the body's cells helps main
    5·2 answers
  • On average, an adult male sea otter weighs 36kg (79lbs), with some individuals weighing as much as 45kg (99lbs). A female weighs
    14·1 answer
  • Write the code for RNA from this DNA STRAND :<br><br> AAAAAATTTTTTCCCGGGGTTTATATATC
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!