1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lina2011 [118]
2 years ago
7

In a eukaryotic cell, a membrane encloses a region of low ph containing enzymes that break down macromolecules. this structure i

s:__________
Biology
1 answer:
Ber [7]2 years ago
3 0

Lysosomes are membrane-enclosed organelles that contain an array of enzymes capable of breaking down all types of biological polymers—proteins, nucleic acids, carbohydrates, and lipids

<h3>What are Eukaryotic cells ?</h3>

Eukaryotes are organisms having cells that contain a nuclear envelope around their nucleus. They are a member of the Eukaryota class of organisms. One of the three domains of life is the eukaryotic domain; the other two are the bacterial and archaeal domains.

  • The nuclear membrane encloses the nucleus in eukaryotic cells. the mitochondria of the cell. In a eukaryotic cell, the locomotory organs are flagella and cilia. The outermost layer of eukaryotic cells is called a cell wall. The process of mitosis is how cells divide.

Learn more about Eukaryotic cells here:

brainly.com/question/495097

#SPJ4

You might be interested in
Which of the following sentence best describes a buffer? Buffers resist change in pH of solutions by neutralizing excess acid or
Marianna [84]
It's the first one where it resist change in pH solutions by neutralizing :)
5 0
4 years ago
Read 2 more answers
Why are communities that are more diverse usually more stable?
serg [7]
<span>It is going to depend on what you consider stable. A diverse population would be more resistant to disease because of simple biology. The more sources for possible resistance the better the heterogeneous pool will be at resisting disease. You also have to take in to consideration things like the availability of modern medicine and the ability to be isolated during illness. </span><span> Personally I think it has to do with the fact that many of the worlds more diverse population centers are also many of the worlds largest population centers which make them less prone to invasion on that basis alone. </span>


7 0
3 years ago
Why is it impossible to predict the phenotype of the offspring by observing only the phenotype of the two parents?
igomit [66]

Because some trait's phenotypes don't indicate their genotypes so in order to predict the phenotype of the offspring you have to know the genotypes of the parents

6 0
4 years ago
Read 2 more answers
Which of the following best describes the structure of a mushroom that you observe above the ground?
Alex Ar [27]

The right answer is Fruiting type.

The sporophore (literally "spore carrier"), also called Fruitbodies, is the reproductive system of the so-called superior mushrooms. It is, in popular language, the organ of the "fructification" of the mushroom mycelium. It contains sporocysts (basid and asci) that differentiate in the hymenium and produce spores in various forms. It is present in the mushroom's cap.

4 0
3 years ago
Read 2 more answers
(This is about DNA)
n200080 [17]

Answer:

B. 20%

Explanation:

The complementary base-pairing rule states that Adenine always pairs with Thymine (A with T), and Cytosine with Guanine (C with G).

Because of this, the amount of Adenine present must be the same as the amount of Thymine present, and the same for Cytosine and Guanine.

This means that if there is 30% Adenine, there is also 30% Thymine as each A base is paired to a T base. This adds to 60%, so Cytosine amounts and Guanine amounts must add to 40% to make 100%.

Since they are equal in amount, there must be 20% of each.

Therefore the answer is B. 20%

There is 30% Adenine, 30% Thymine, 20% Guanine and 20% Cytosine.

Hope this helped!

6 0
3 years ago
Other questions:
  • List 3 things that affect the rate of photosynthesis
    5·2 answers
  • Tammy and maureen enjoy a glass of wine with dinner. after the meal, each woman has a cigarette with a cup of coffee. how many p
    9·2 answers
  • What is the cell membrane is made of
    7·2 answers
  • In a _______ cross, the chance of the dominant phenotype showing up in one of the offspring is 3/4. dominant monohybrid dihybrid
    13·1 answer
  • What are some of the autoimmune diseases
    6·1 answer
  • Oxygen diffuses from the _________ to the _________ where it enters red blood cells.
    12·1 answer
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • The human body uses specialized biomolecules to speed up chemical reactions. These are called enzymes. Without enzymes, the reac
    7·1 answer
  • What is the most abundant source of the body's water?
    14·1 answer
  • B. Will using farmland to grow crops for ethanol cause food shortages and increase<br> food prices?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!