After two months of
development, the embryo is called a fetus. The endometrium is formed in part
from the inner lining of the uterus and in part from other membranes. It is
through the placenta that that the embryo/fetus is nourished while in the
umbilical cord and three blood vessels are carried away.
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
The process in which the environment<span> selects </span>organisms<span> that will survive is called natural selection. It starts with overproduction; when an </span>organism<span> produces more offpsrings than can survive. The second is variation. Because there are so many offsprings, there will be variations.</span>
Answer:
1. Stabilizing Selection
2. Directional Selection
3. Disruptive Selection
Explanation:
Stabilizing Selection
This type of natural selection occurs when there are selective pressures working against two extremes of a trait and therefore the intermediate or “middle” trait is selected for. If we look at a distribution of traits in the population, it is noticeable that a standard distribution is followed:
Example: For a plant, the plants that are very tall are exposed to more wind and are at risk of being blown over. The plants that are very short fail to get enough sunlight to prosper. Therefore, the plants that are a middle height between the two get both enough sunlight and protection from the wind.
Directional Selection
This type of natural selection occurs when selective pressures are working in favour of one extreme of a trait. Therefore when looking at a distribution of traits in a population, a graph tends to lean more to one side:
Example: Giraffes with the longest necks are able to reach more leaves to each. Selective pressures will work in the advantage of the longer neck giraffes and therefore the distribution of the trait within the population will shift towards the longer neck trait.
Disruptive Selection
This type of natural selection occurs when selective pressures are working in favour of the two extremes and against the intermediate trait. This type of selection is not as common. When looking at a trait distribution, there are two higher peaks on both ends with a minimum in the middle as such:
Example: An area that has black, white and grey bunnies contains both black and white rocks. Both the traits for white and black will be favored by natural selection since they both prove useful for camouflage. The intermediate trait of grey does not prove as useful and therefore selective pressures act against the trait.
<h2>Law of independent assortment </h2>
Explanation:
- There are 8 distinct phenotypes, each one has a 12,5% of appearance: Since M=solid leaves D=normal height P= smooth skin.
- Recessive gene characters can only be taken in homozygous recessive mmddpp.
1. MmDdPp: M=solid leaves D=normal height P= smooth skin.
2. MmDdpp M=solid leaves D=normal height pp= peach skin.
3. MmddPp M=solid leaves dd=dwarf height P= smooth skin.
4. Mmddpp M=solid leaves dd=dwarf height pp= peach skin.
5. mmDdPp mm=mottled leaves D=normal height P= smooth skin.
6. mmDdpp mm=mottled leaves D=normal height pp= peach skin.
7. mmddPp mm=mottled leaves dd=dwarf height P= smooth skin.
8. mmddpp mm=mottled leaves dd=dwarf height pp= peach skin.
Hence,The answer is all eight possible phenotypes from the cross MmDdPp x mmddpp are equally likely, resulting in a phenotypic ratio of 1:1:1:1:1:1:1:1
