1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Brums [2.3K]
2 years ago
11

Which vital sign can be controlled consciously?

Biology
1 answer:
GuDViN [60]2 years ago
6 0

Answer: Respirations

Explanation:

You might be interested in
What do the following results from the TEST FOR LIFE tab indicate about the sample?
Luda [366]

Answer:

What do the following results from the TEST FOR LIFE tab indicate about the sample? The sample produces ATP.

6 0
3 years ago
Nitrogen fixation, the process of making nitrogen usable for living things, happen most in
Nady [450]

Answer:

The nitrogen gas must be changed to a form called nitrates, which plants can absorb through their roots. The process of changing nitrogen gas to nitrates is called nitrogen fixation. It is carried out by nitrogen-fixing bacteria. The bacteria live in soil and roots of legumes, such as peas.

4 0
3 years ago
Which of these best completes this concept map?
Vesnalui [34]

Answer:

C. Virus

Explanation:

6 0
3 years ago
Who discovered the impermanence of sexual phenotypes?
Yuliya22 [10]
Daniel Nathans and Hamilton Smith who discover the Impermanence of Sexual Phenotypes as to the absolute statement.
Phenotypic sex is refer to an individual's sex as intent by their internal genitalia, expression of secondary sex attribute, and behavior.
4 0
3 years ago
Which of the following professionals would be most likely to raise commercial nut-bearing trees?
Alexus [3.1K]

Answer:

florist professional would be most likely to raise commercial nut bearing trees.

4 0
3 years ago
Other questions:
  • In eukaryotic cells what happens in the g1 phase that differs from the g2 phase
    13·2 answers
  • Define agglutinogen and agglutinins??
    8·1 answer
  • HURRY!! PLEASE
    5·2 answers
  • This is an early hominid who lived between 2–3 million years ago in the Pliocene and is thought to be a direct ancestor of moder
    6·1 answer
  • Individuals do not evolve.Populations evolve. True or False?​
    11·2 answers
  • The curve on the left shows the height of a population of penguins. The curve on the right shows the population five years later
    6·2 answers
  • Which definition best describes a base?
    10·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Once a standard curve has been prepared by plotting numbers of bacteria (CFU/mL) versus absorbance for one species of bacteria,
    12·1 answer
  • A plant cell can be distinguished from an animal cell because of the presence of?​
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!