Answer:
1.AATACGGGGGCGTAACCACTA
mRNA: UUAUGCCCCCGCAUUGGUGAU
Amino Acid: Leu, Cys, Pro, Arg, Ile, Gly, Asp
2.GCTAGTACGTGCACATTAGAA
mRNA: CGAUCAUGCACGUGUAAUCUU
Amino Acid: Arg, Ser, Cys, Thr, Cys, Ans, Leu
Explanation:
I abbriviated the amino acids. If you ever need to find the mRNA of DNA, apply the smae rules to the mRNA but A goes with U.
RNA : Replace Thymine (T) with Uracil (U)
To find amino acids: Use an mRNA codon
Answer:
conduction
Explanation:
Since ectotherms lack the capacity to generate heat within their body, one of the mechanisms they use in generating heat from the environment in order to maintain constant body temperature is, <em>energy transfer by conduction</em>. Conduction occurs when a lizard lays directly onto a hot rock.
Heat from the sun is transferred to the rock by radiation as the rock absorb the heat energy. This heat that is radiated in the rock is then transferred to a lizard that lays on it through conduction, and as the lizard absorbs this heat from the rock, they become warm.
- Energy transfer by conduction is mainly achieved through direct contact, and this is one of the methods that ectotherms like lizard rely upon to maintain constant body temperature.
The answer to your question is B. DNA
Answer:
For tropical forest restoration to result in long-term biodiversity gains, native trees must establish self-sustaining populations in degraded sites. While many have asked how seedling recruitment varies between restoration treatments, the long-term fate of these recruits remains unknown. We address this research gap by tracking natural recruits of 27 species during the first 7 years of a tropical forest restoration experiment that included both planted and naturally regenerating plots. We used an individual-based model to estimate the probability that a seedling achieves reproductive maturity after several years of growth and survival. We found an advantage for recruits in naturally regenerating plots, with up to 40% increased probability of reproduction in this treatment, relative to planted plots. The demographic advantage of natural regeneration was highest for mid-successional species, with relatively minor differences between treatments for early-successional species. Our research demonstrates the consequences of restoration decision making across the life cycle of tropical tree species.
Explanation:
Answer:
d. RNA polymerase II.
Explanation:
The main enzyme responsible for RNA synthesis is RNA polymerase, which <em>catalyzes the polymerization of 5'-triphosphate ribonucleosides (NTP) </em>directed by a DNA mold.
Eukaryotic cells contain <u>three types of nuclear RNA polymerases</u> that transcribe different types of genes. Protein-encoding genes are transcribed by RNA polymerase II to give mRNA.
