1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Digiron [165]
1 year ago
12

The ability to identify the specific location of skin touch in two different areas is communicated through which pathway?

Biology
1 answer:
Elden [556K]1 year ago
8 0

The ability to identify the specific location of skin touch in two different areas is communicated through sensory pathway .

<h3>What is sensory pathway?</h3>

The cerebral cortex or the cerebellum are the two destinations of the brain, and sensory pathways are the channels by which sensations or impulses travel from sense organs or receptors to the response centers there. While cerebellar impulses are important in coordination functions, cerebral cortex impulses enter through the thalamus and travel to the conscious portion of the brain.

Ascending and descending tracts make up the majority of the sensory pathways.

Learn more about sensations with the help of the given link:

brainly.com/question/27818707

#SPJ4



You might be interested in
What is a triacylglycerol ? Discuss the advantages of organisms having triacylglycerol as energy storage molecule?
Sergeeva-Olga [200]

Answer:

Triacylglycerols are acylglycerols with three fatty acid molecules, generally long chain, which can be the same or different; we speak of simple triacylglycerols when there is the same fatty acid in all three glycerol positions, but most are mixed triacylglycerols, with at least two different fatty acids. The properties of triacylglycerols will depend on the type of fatty acids they contain.

Most of the fats and oils of both animal origin (tallow, butter) and vegetable (olive, corn, sunflower, palm, and coconut oils) are formed almost exclusively by triacylglycerols.

Physiologically, triacylglycerols are an important energy reserve. In most eukaryotic cells, triacylglycerols are stored in the cytosol as microscopic fat droplets. In vertebrates there are specialized cells in the storage of fat, adipocytes. In humans, the presence of fatty tissue under the skin, in the abdominal cavity and in the mammary gland stands out.

5 0
3 years ago
Nitrogen fixation is a process that changes nitrogen within plants and soil into_____
k0ka [10]
Nitrogen fixation is a process that changes nitrogen within plants and soil into"nitrogen compounds"
3 0
3 years ago
1. During a heart attack, some of the cells in the thick layer of muscle in the heart walls die. This layer of muscle is called
Strike441 [17]
Myocardium, that's because myocardium simply means 'muscular tissue of the heart'. It is not pericardium or connective tissue as these are only small, specific areas of the heart and a heart attack can cause cells to die anywhere in the heart.
6 0
3 years ago
Read 2 more answers
What structure in the brain receives sensory input from all over the body and then relays that information, via other neurons, t
zhenek [66]
A part of the brain known as the sensory cortex receives information from all over the body. The sensory vortex is located above the pons. :))
4 0
3 years ago
A role can be defined as
vovangra [49]

Answer:

The set of prescribed behaviors that are associated with a particular social position.

Explanation:

A role in a society is a behavior that we do as part of our position that we have in that society. There are many roles that we do on a daily basis. These can be gender roles, parental roles, the roles we do at a given job position, and many others. We all know the role of a firefighter because we know what to expect from that role in society.

8 0
2 years ago
Other questions:
  • What process causes behavior patterns to change over generations as a result of reproductive success?
    7·2 answers
  • What does a red blood cell look like at in 0.65M solution
    5·1 answer
  • Which is the most accurate description of an ecosystem
    10·1 answer
  • Which conditions are most favorable for the formation of radiation fog?
    10·1 answer
  • A piece of iron is heated and then cooled by dropping it in water. The heat lost by the piece would be higher if
    14·1 answer
  • Turtles, lizards, snakes, and crocodiles are which of the following? select one of the options below as your answer:
    10·2 answers
  • The sugar industry is on a decline. To boost sales, sugar executives decide to make a new commercial encouraging consumers to ea
    11·1 answer
  • What should a person eat if she wants the fastest supply of energy?
    13·2 answers
  • In the carbon cycle, carbon is taken in by plants A) as ammonia in the process of assimilation B) as carbon dioxide in the proce
    5·1 answer
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!