1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Scrat [10]
2 years ago
11

A population of mammals leaves an ecosystem because of increased temperatures and decreased rainfall. what’s the reason for this

shift?
Biology
1 answer:
Serga [27]2 years ago
8 0

The reason for the shift of mammals from the ecosystem due to increased temperatures and decreased rainfall is the change in the abiotic factors of that region.

Ecosystem is defined as how the living species of an area interact within themselves as well as the with the abiotic factors of the region.

Abiotic factors are the non-living things present in an area. These are the soil, mountains, temperature, sun, water, etc. The livelihood of a species in an area is influenced by both the living as well as the non-living factors. For example, if an organism can survive only in high rainfall then low amount of rainfall will be unfavorable condition for it to survive and grow efficiently.

To know more about ecosystem, here

brainly.com/question/13979184

#SPJ4

You might be interested in
Which statement concerning an ecosystem is correct?
kondor19780726 [428]
Considering the following statements;
A. It can exist without a constant source of energy input
B. It must contain consumers but can exist without producers.
C. It involves interactions between biotic and abiotic factors.
D. It can exist on land, but it cannot exist in lakes, rivers, or oceans.
The correct statement is C. that an ecosystem involves interactions between biotic and abiotic factors. 
Biotic factors are the living things in an ecosytem, they include plants, animals, bacteria, fungi and others. Abiotic factors on the other hand, are the non-living factors in an ecosystem, they include water and air, sunlight, the amount precipitation in an ecosystem is also an example of abiotic factor. The two types of factors are crucial for an ecosystem to exist and thrive. 

7 0
3 years ago
27. some farmers use manure on their crop fields. how does this help the plants?
Marina86 [1]
Manure supplies plants instantly with nitrogen, phosphorus, potassium and other nutrients by warming the soil
8 0
3 years ago
Which statement is true about light when it slows down upon entering another medium?
Alchen [17]
The answer is "a" if the second word is "bends" not "burns".
8 0
3 years ago
Read 2 more answers
How has the population in South Carolina changed over the last 20 years?
Lesechka [4]

Answer: The troubling reality of humanity's over-sized and still expanding population and create highly effective programs to solve the problem. Our efforts focus on specific attitudinal drivers of ongoing rapid population growth.

Explanation: In fact, world population growth remains totally unsustainable over 230,000 people are added to world population each day. That is a net gain - births minus deaths. But few people understand the true drivers of this increasing world population. Even fewer know how to effectively intervene.  Long established and widely practiced social norms low status of women & girls, bias against modern contraception, and large ideal family size are the strongest drivers rapid growth of the population. If somebody tries to tell you that population growth is "slowing down," ask them to explain the graphic on the left.

8 0
3 years ago
Explain why there is no glucose ni urine​
7nadin3 [17]

Urine contains no glucose because the kidneys  reabsorb all the glucose from the long/tube-shaped fluid back into our bloodstream.

3 0
3 years ago
Read 2 more answers
Other questions:
  • Which element is found in most meteorites?
    12·2 answers
  • What caused the taino population on hispaniola to drop from 500,000 to a few hundred by 1542?
    14·1 answer
  • How do scientists use radioactive decay to date fossils and artifacts
    14·1 answer
  • What type of hair cell damage in cochlear implant?
    11·1 answer
  • _____________ bonds form in order to fill the valence shells of the participating atoms.
    8·1 answer
  • Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
    7·1 answer
  • Geologists discovered that the largest coal deposits were formed around 300 million years ago. How did this observation support
    14·1 answer
  • The explanation for energy​
    5·1 answer
  • How large and power full can a tsunami be, put in your own words​
    13·2 answers
  • What is this? Please answer with an explanation
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!