1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
RSB [31]
1 year ago
8

What alternative form of genes do nucleic acids have that allows them to offer variability?

Biology
1 answer:
inna [77]1 year ago
4 0

The answer to the above question is alleles.

<h3>What are Alleles?</h3>

The two nucleic acids in living things that are employed for conveying and storing genetic information are RNA and DNA. The genetic material in living things is called deoxyribonucleic acid (DNA), and it contains sections coding for beneficial proteins and products as well as carrying genetic information from one generation to the next. These chunks are referred to as genes.

However, genes also have a different form that is in charge of the genetic diversity in the qualities they are coding for. Allele refers to a gene's alternative or variant version. In a diploid creature like the human, each trait is encoded by genes that include contrasting pairs of alleles, allowing variation for that specific trait, i.e. two alleles for each gene. For instance, a gene with two alleles that codes for one of the human height traits includes the short variety (t) and the tall variety (T).

To learn more about alleles with the help of given link:

brainly.com/question/3452155

#SPJ4

You might be interested in
Matching. Each letter may be used once, more than once or not at all.
Zinaida [17]

Answer:

Occurs in chloroplast- Photosynthesis

Carbon dioxide and water  are converted to sugar- photosynthesis

Occurs in plant cells- respiration and photosynthesis

Occurs in the mitochondria - respiration

Occurs in the cells to give  energy needed for life processes-respiration and photosynthesis

3 0
2 years ago
GRA
Ainat [17]
Yes it is right i did it
5 0
2 years ago
Briefly outline the steps involved in glycogen synthesis and breakdown and explain the regulatory mechanism involved in glycogen
Elenna [48]

Answer:

Glycogen is synthesized and degraded by different pathways, which provide greater flexibility for energy production through its degradation or for storage in its synthesis and thus maintain control of both metabolic pathways.

Explanation:

Synthesis and degradation pathways:

1º.- activation of glucose units at UDP-glucose.

UDP-glucose is an activated form of glucose, which is formed in a reaction catalyzed by UDP-glucose, which is formed in a reaction catalyzed by UDP-glucose pyrophosphorylase. This reaction is an example of biosynthetic reactions that are directed by the hydrolysis of pyrophosphate (PPi-2Pi).

Many biosynthetic reactions are directed by the hydrolysis of pyrophosphate, which catalyzes pyrophosphate hydrolase or pyrophosphatase, and is very favorable thermodynamically.

2nd.- polymerization or addition of glucose units to glycogen. Two steps: addition and branching.

 UDP-glucose acts as the giver of glucose units for glycogen synthesis. Glucose transfer

from the UDP-glucose to a growing glycogen chain is catalyzed by glycogen synthase.

A branching enzyme [amyl (1,4 -> 1,6) -transglucosidase], moves a chain of about seven glucose residues, to form

bonds (α1-> 6) at the branching points.

To start glycogen synthesis, glycogen synthase is only effective when it is linked to glycogenin. Glycogenin is

an oligosaccharide carrier protein formed by glucose units with linkages (α1-> 4).

6 0
3 years ago
All of the following are changes brought about by the geological process except
Elanso [62]
What I Think It Is, Global Warming :)
5 0
3 years ago
he sequence of this single strand of DNA is ATTCGGCTATTTACGATTGCCAT. To complete this model, what should the nucleotides on the
Ugo [173]

Answer:

TAAGCCGATAAATGCTAACGGTA

Explanation:

Adenine (A) pairs with Thymine (T) [Apples grow on Trees]

Cytosine (C) pairs with Guanine (G) [Cows eat Grass]

Therefore using this complimentary bonding system we just assing each nucleotide its complimentary pair

ATTCGGCTATTTACGATTGCCAT ----- Original Parental strand

TAAGCCGATAAATGCTAACGGTA ------- New strand

5 0
2 years ago
Other questions:
  • Which THREE statements correctly describe the properties of water?
    8·1 answer
  • Yellowfin tuna are large fish that are found in tropical and subtropical waters around the world. They typically school under ob
    15·2 answers
  • What is one role that lipids play in the body
    7·2 answers
  • Approximately _____% of the energy at one trophic level is passed on to the next highest trophic level.
    5·2 answers
  • Which of the following biological factors plays a role in the development of generalized anxiety disorder? a. elevated levels of
    14·1 answer
  • Monomers are made up of many polymer units. True or False
    12·1 answer
  • Qual é o ciclo de vida das moscas ? Relate todas as fases , desde o ovo até a morte
    6·1 answer
  • The following map shows the average monthly precipitation in the western United States. The areas in dark blue have very high am
    7·2 answers
  • 2. An example of an internal stimulus
    5·1 answer
  • Which is/are not involved in the construction of the basal transcription apparatus?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!