1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Harman [31]
2 years ago
9

The intellectual trait that is the opposite of intellectual empathy is? intellectual cowardice. intellectual narrow-mindedness.

intellectual humility. intellectual autonomy.
Biology
1 answer:
coldgirl [10]2 years ago
4 0

The  opposite of intellectual empathy is intellectual narrow mindedness.

<h3>What does intellectual empathy mean?</h3>

Intellectual empathy involves the ability to imaginatively put oneself in the place of others in order to genuinely understand them .

Example of intellectual empathy is when an individual achieves intellectual empathy when they actively put themselves in someone else's shoes in terms of how they think and feel.

It's opposite is is intellectual narrow mindedness . It is thinking centered on self .

to learn more about Intellectual empathy click here

brainly.com/question/28433704

#SPJ4

You might be interested in
1. The effect of initial population sizes on the growth of populations of an organism was
ella [17]

When graphing data, we must consider the variables, label axes, define units of measure. In this case, variables are initial population size / final population size, showing an directly proportional relationship.

-------------------------------------

We need to construct a graph illustrating the data in the table.

We can make a <u>dispersion graph</u>. To do it, we need to define variables.

Since we want to know how <em>different initial population sizes affect population growth, </em>

  • the independent variable is the initial population size
  • the dependent variable is the final population size (after 24 hours)

The final population size depends on the initial population size. This is, <em>the number of individuals at the beginning will </em><em>influence</em><em> the final number of individuals</em>.

  • Initial population sizes ⇒X horizontal ax ⇒Unit: Number of individuals
  • Final population sizes ⇒ Y vertical ax ⇒ Unit: Number of individuals

By making a dispersion graph, we can represent the effect of the varying initial population sizes on the final population sizes. We can compare these effects and observe how populations grow as the N₀ increases.

We can also choose a <u>bar graph</u>. In this way, we can compare initial and final population sizes.

This graph will show populations and two bars per population.

  • Blue bar ⇒N₀⇒ Initial population size
  • Red bar ⇒N₁ ⇒ Final population size
  • Different populations ⇒ 1, 2, 3, 4, 5 ⇒ Represented in the X horizontal ax
  • The number of individuals ⇒ from 1 to 324 ⇒ Represented in the Y vertical ax.

By making a bar graph, we can represent initial and final population sizes and compare them. <em>The population that begins with 1 individual, after 24 hours has 4 individuals. The population that begins with 3 individuals, ends with 9 individuals. And so on</em>.

No matter which graph you choose, you will observe a directly proportional relationship between both variables. The bigger is the initial population size, the bigger it ends after 24 hs.

---------------------------------

Related link: brainly.com/question/24827485

Download pdf
<span class="sg-text sg-text--link sg-text--bold sg-text--link-disabled sg-text--blue-dark"> pdf </span>
<span class="sg-text sg-text--link sg-text--bold sg-text--link-disabled sg-text--blue-dark"> pdf </span>
5 0
3 years ago
Match the term or phrase with the correct macromolecule. Note that a macromolecule may be used more than once or not at all.
ELEN [110]

Answer:

1. Carbohydrate

2. Carbohydrate

3.  Lipids

4. Proteins

5. Nucleic Acids

6. Lipids

7. Proteins

8. Nucleic Acids

Explanation:

1. Carbohydrate is used as primary source of energy in cells as each sugar molecule in carbohydrate breaks and form high energy ATP, which is primary energy utilized by  all cells.

2. Carbohydrates  have the basic formula CH2O as carbohydrate is composed of of carbon and a 2:1 ratio of hydrogen to oxygen.

3. Lipids or fatty acid can be saturated or unsaturated, it depends on the number of hydrogen in the tail. Saturated fatty acids have single bonds while unsaturated fatty acid have some missing hydrogen in tail and form double bond.

4. Enzymes are example of proteins because enzymes are made up of many amino acids binded in a very specific and unique order and amino acid are building blocks of proteins.

5. Nucleic acid is the monomer consist of nucleotide as all nucleic acids are made up of same five pieces are uracil, guanine, thymine, cytosine, and adenine.

6. Lipids are considered as hydrophobic as it is composed of carbon and hydrogen and have mostly nonpolar carbon–hydrogen or carbon–carbon bonds.

7. Proteins are most complex macromolecules as they made up of  hundreds of amino acids and each amino acid has its own specific shape. All the properties of proteins depends on these specific amino acids

8. when some one look into mirror, they see their own image or phenotype characters which are due to the genetic makeup in the body. DNA is responsible for the phenotype and genotype where DNA is a nucleic acid. Hence, the , one will see while looking in the mirror is nucleic acid.

4 0
4 years ago
Between which two steps of the water cycle does the ocean fit
Tems11 [23]
The whole water cycle is evaporation, condensation, precipitation, and then infiltration, and at last it is runoff. 
Ocean is between the runoff and the evaporation. The rain runoff to the ocean and then start over the water cycle from evaporation.
6 0
3 years ago
Read 2 more answers
Question 6 of 10
Delvig [45]

Answer:

matter is:  Anything that takes up space and has mass

5 0
3 years ago
What is the difference between copper and silver
DanielleElmas [232]

Copper and Silver are both different elements.

3 0
3 years ago
Other questions:
  • What is an advantage of using mulitiple lines on a line graph
    10·1 answer
  • Antigen processing and presentation Antigen processing and presentation
    8·1 answer
  • Please select the word from the list that best fits the definition
    7·2 answers
  • An expiriment was done to determine if the rate at wich a patato cooked depended on the temperature of water in which it was boi
    7·1 answer
  • Identify and describe the evidence that supports the idea that Neandertals were not the ancestor of Cro-Magnon people.
    9·1 answer
  • Use the image below to answer the following question
    7·1 answer
  • Other than wind, the most significant factor that influences the movement of ocean water at the surface is the
    12·2 answers
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • during the embryonic period, the embryo develops according to the proximodistal principle, which means that:
    11·1 answer
  • What is the height and length of a arctic tern?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!