nope but i have dissected a big boy pigyyy fetus
Answer:
Mental process is a term used for the things that an individual can do with their minds; perception, memory, thinking, volition, and emotion. Cognitive function is sometimes used instead.
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
Answer:
1) Increased probability of hazardous chemical contamination.
2) Air, water, and soil pollution.
3) Mortality in both terrestrial and aquatic organisms.
4) Development of diseases in humans.
Explanation:
The improper disposal of electronic waste can have detrimental consequences for the environment and, as a result, to all living beings including humans.
If electronic waste is thrown away in an open area, it warms up and releases hazardous chemicals that are detrimental for the health of living beings. This occurs because <u>electronic objects contain toxic chemicals such as lead, mercury, cadmium, amongst others</u>.
These chemicals will eventually enter both soil and water, harming thousands to millions of terrestrial and aquatic organisms. Moreover, these chemicals will enter the food chain and, as humans consume these affected organisms, we are also affected in numerous ways. For example, ingesting these chemicals could cause reproductive issues, damage to both the nervous and digestive systems, the development of cancer, etc.
Answer:
Carrying Capacity
Explanation:
The definition of carrying capacity in relation to biology is, "the number of people, other living organisms, or crops that a region can support without environmental degradation."
