1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
djverab [1.8K]
1 year ago
5

What happens if you disclose classified information?

Law
1 answer:
Vedmedyk [2.9K]1 year ago
8 0

According to the Espionage Act, it is illegal to intentionally disclose classified information without consent. Up to ten years in prison, a hefty fine, or even being accused of treason are possible penalties.

The disclosure of classified material is prohibited by a number of federal statutes. The law bans the knowing and intentional transmission of specific classified information to an unauthorized person under Title 18 of the United States Code, Section 798. Only information about American communications intelligence systems and operations is covered in this section. Any of the following actions concerning sensitive information that are done knowingly and willingly are illegal:

  1. communication, provision, transmission, or availability in any other way to an unauthorized individual
  2. Release it
  3. Use it in a manner that is harmful to government interests or safety.

A conviction for unauthorized disclosure carries a sentence of up to 10 years in jail, a large fine, or both.

To know more about classified information, refer:

brainly.com/question/25031712

#SPJ4

You might be interested in
What type of evidence do you think might be found at each of the following crime scenes? List at least one example for each.
Andrews [41]

Answer:

In the shooting scene, you'd be able to collect the shell of the bullet and that would be one step to find out what type of gun the perpetrator used. You could go through nearby stores and look through their CCTV camera and find out what kind of car it was and maybe even catch a glimpse of the perpetrators face. However if the shooting was in a residential area you could go door to door looking for witnesses. To see if anybody heard or saw anything.

5 0
3 years ago
Explain factors taken into consideration to determine the similarity of a name for it to be called “undesirable” under section 2
Komok [63]

Answer:

Explain factors taken into consideration to determine the similarity of a name for it to be called “undesirable” under section 24 of the Companies Act (Chapter 24:03

5 0
3 years ago
10 When your ability to divide your attention is impaired, the chances of being involved in a collision increase. A BAL as low a
Black_prince [1.1K]
.08 is the legal BAC
5 0
3 years ago
Read 2 more answers
A "certification of license status" report can be run on any currently licensed New Jersey producer, but can only contain inform
Elan Coil [88]

Answer:

7

Explanation:

5 0
3 years ago
How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCAT
andreyandreev [35.5K]

Answer:

The number of repeats within an STR is referred to as an allele. For instance, the STR known as D7S820, found on chromosome 7, contains between 5 and 16 repeats of GATA. Therefore, there are 12 different alleles possible for the D7S820 STR.

7 0
3 years ago
Other questions:
  • The vehicle code includes regulations regarding?
    15·2 answers
  • Another name for legal penalties is
    11·2 answers
  • How can the Criminalization be reformed
    15·1 answer
  • Bem-vindo à Seção 3! Na audiência UNA (única), que ocorreu no dia 2/2/2020, às 9h, ambas as partes compareceram acompanhadas de
    12·1 answer
  • Which of the following types of federal prisons have the lowest staff to inmate ratio
    13·1 answer
  • What is the most important requirement to perform a legal search?
    6·2 answers
  • Yeah. Yeah<br> Just space<br> ajdkasdksfakjhdsfjkh
    6·2 answers
  • I found a website that is a offbrand of this website, and keeps on sending me images of girls off from dating sites, what should
    7·1 answer
  • 1/5 and 1/6 - High Risk Stops
    6·1 answer
  • Which of the following would NOT be a reason people create government?
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!