1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Brut [27]
1 year ago
12

How does studying cells help us to understand life?

Biology
1 answer:
Marina CMI [18]1 year ago
6 0
Studying cells helps us to construct better medicines and vaccines, which is beneficial to understanding life.
You might be interested in
A DNA strand with the sequence A-T-T-G-C-T would be complementary to which of the
tensa zangetsu [6.8K]
The answer to this would be “ T-A-A-C-G-A “
8 0
3 years ago
.<br> the study of the body's parts and how they are put together
Sergeu [11.5K]

Answer: organ system

Explanation:

3 0
2 years ago
Why are Cells sometimes referred to as "Life's Atoms?
Marysya12 [62]

Answer:

Cells are sometimes referred to as "life's atoms" because there the basic units of life. All cells are surrounded by a structure called the cell membrane — which, serves as a clear boundary between the cell's internal and external environments.

4 0
3 years ago
Read 2 more answers
The diagram below shows the change in plant species during ecological sucession, beginning with the pioneer species. What types
ASHA 777 [7]
Fish and turtles and snakes
6 0
2 years ago
In what ways has poland suffered because of its lack of natural barriers
nikitadnepr [17]
<span>The region of Poland has suffered from the few limits of European states with respect to the international politics of the 20th century. The variations of the borders of Poland is due to the absence of natural barriers in the east-west. The extension of the border is the cause of constant changes in stability that have shaken the country and the inhabitants.</span>
7 0
3 years ago
Read 2 more answers
Other questions:
  • Which parts do BOTH animal and plant cells have?
    13·2 answers
  • Why do temperatures on the moon’s surface vary so much?
    6·2 answers
  • Give one reason that almost all coral growth occurs within 40 meters of the ocean’s surface.
    12·2 answers
  • Which factor most significantly increases the impact the disease has on a population
    13·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Which of the following is an incorrect match? a. endocytosis – substances taken into the cell b. exocytosis – substances secrete
    5·1 answer
  • 5. In 1928, Alexander Fleming noticed that a mysterious blue-green fungus had grown on some bacterial colonies that were known t
    15·1 answer
  • 5 uses of domestic animal
    10·2 answers
  • Fred wants to summarize mitosis in the cell cycle. Which statement describes mitosis?
    15·2 answers
  • Who want to play a CaHoot.772 645 is the code
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!