1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ira Lisetskai [31]
1 year ago
9

According to biochemist sidney fox, once amino acids formed in the oceans, they may have collected in small pools to form small

polypeptides called.
Biology
1 answer:
Blizzard [7]1 year ago
8 0

Formed tiny polypeptides known as Proteinoids when they gathered in little pools.

<h3>What is a polypeptide and how does it work?</h3>

Polypeptides. By joining many amino acids together, polypeptides contribute to the creation of proteins. When two or more polypeptides are joined together to form a protein, the resulting structure is unique to that protein.

<h3>What conclusions did Sidney Fox's experiment reach?</h3>

In the 1950s, Sidney Fox demonstrated that when amino acids were splashed in hot, dry circumstances, they immediately polymerized into proteins. Other studies that used cyanide, clays, and heat to cause the polymerization of amino acids into proteins were effective.

To know more about polypeptide visit:-

brainly.com/question/28270191

#SPJ4

You might be interested in
What are mutations and how do they affect an organism?
Makovka662 [10]

Answer:

Mutations can affect an organism by changing its physical characteristics (or phenotype) or it can impact the way DNA codes the genetic information (genotype). When mutations occur they can cause termination (death) of an organism or they can be partially lethal

Explanation:

4 0
2 years ago
Smokers, alcohol abusers, overweight and obesity men are more<br> likely to have sperm which are?
luda_lava [24]

Answer:

fewer in number.

Explanation:

A low sperm count also known as oligospermia can be defined as a medical condition which typically involves a man (adult male) having fewer than 15 million sperm per millilitre of semen.

Basically, low sperm count (oligospermia) is usually caused in men due to health and lifestyle factors such as smoking, alcohol or drug abuse, obesity, genetics, sexually transmitted infections (STIs), age etc.

Hence, smokers, alcohol abusers, overweight and obesity men are more likely to have sperm which are fewer in number i.e fewer than 15 million sperm per millilitre of semen.

Generally, a healthy or normal sperm motility ranges from over 20 million to 200 million sperm per millilitre of semen.

7 0
3 years ago
Matching: In the space provided, write the letter of the phase during which each event
artcher [175]

Answer:

25: B.

26: D.

27: C.

28: C.

29: A. (I'm not fully sure about this one....)

30: D.

31: B.

32: F. (Again, not fully sure, but <em>pretty</em> sure)

5 0
2 years ago
Which process is responsible for continually wearing away the Earth's surface? deposition folding erosion faulting
hoa [83]

<u>Answer:</u>      Erosion

<em>The process in which there is a wearing down on the surface on the earth which goes through the erosion is called gradation.</em>

<u>Explanation:</u>

There is a certain force which is the cause for the <em>formation of earth’s surface and that force is called as endogenic forces. </em>

There may come up a question about how the <em>surface of the earth</em> is not even, the reason is due to exogenic process failing to even out <em>the variation of the land.</em>

6 0
3 years ago
Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
trapecia [35]

Answer:

idk

Explanation:

im very sorry about this but i dont know the answer

7 0
3 years ago
Other questions:
  • The table above shows five different types of chromosomal abnormalities that can occur during meiosis. They result in either an
    9·1 answer
  • What is the difference between meiosis and mitosis?
    7·1 answer
  • The extremely high __________ within Earth prevents rock from melting.
    12·2 answers
  • Effector organs include: (select all that apply):
    6·1 answer
  • What causes fatty acids to be saturated and unsaturated?
    11·1 answer
  • Which organ produces estrogen and progesterone?<br> Uterus<br> Ovaries<br> Fallopian tubes
    11·2 answers
  • A part of the auditory pathway responsible for auditory reflexes is the
    12·1 answer
  • What occurs if the Dna is used up​
    7·1 answer
  • What is the importance of fermenter of genetic engineering?​
    7·1 answer
  • Imagine what happens if materials are not send out of the body from time to time ?​
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!