1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Gwar [14]
1 year ago
7

The adaptive advantage of a fungus producing and secreting a bacterial inhibitor would be that it protects against microbial com

petitors 
Biology
1 answer:
Advocard [28]1 year ago
5 0

The adaptive advantage of a fungus producing and secreting a bacterial inhibitor would be that it protects against microbial competitors: is an extensive surface area well suited for invasive growth and absorptive nutrition.

Fungus

A fungus is any eukaryotic organism that includes microbes like yeasts and moulds, as well as the more recognisable mushrooms. These organisms are classed as a kingdom distinct from the other eukaryotic kingdoms, which include Plantae, Animalia, Protozoa, and Chromista in one traditional taxonomy.

The presence of chitin in fungi's cell walls distinguishes them from plants, bacteria, and some protists. Fungi, like animals, are heterotrophs; they obtain nourishment by absorbing dissolved molecules, usually by secreting digestive enzymes into their surroundings.

Fungi, like plants, use chemical defence, which involves the creation of poisons that affect the growth, development, or viability of the antagonists.

To learn more about fungus

brainly.com/question/10878050

#SPJ1

You might be interested in
Muticellular organisms, cells are organized into tissues, tissues into organs, organs into organ systems, and system into organi
andrew-mc [135]

Answer:

Explanation:

.

5 0
2 years ago
What is homeostatis? a.how organ systems develop with organs that have related functions B.the process of cells specializing to
tatiyna

Answer:

D. how the body keeps its internal environment stable

Explanation:

Homoestasis is any process that living things use to actively maintain fairly stable conditions necessary for survival.

7 0
2 years ago
What is the thread like structure that helps bacteria hold onto surfaces
Margaret [11]
Fimbriae is the word you're looking for
4 0
3 years ago
PLEASE HELP!!!!!<br><br><br><br> What happens during human reproduction?
marissa [1.9K]

Answer:

A baby is made

Explanation:

The sperm cell (from the man) and the egg cell (from the woman) combined, makes Zygote, the Zygote converts into the Embryo, and the Embryo converts into the Baby.

Hope this helped!

Have a supercalifragilisticexpialidocious day!

3 0
2 years ago
Read 2 more answers
Classify a pet dog as an autotroph or heterotroph and as an herbivore,carnivore, or omnivore. explain
Soloha48 [4]
It would be a heterotroph and a omnivore because it eats grains and meats and a heterotroph because it has to get food.
8 0
3 years ago
Read 2 more answers
Other questions:
  • Many toxins and poisons block certain enzymes in the mitochondria. For example, many fruits, including apricots, apples, plums,
    14·1 answer
  • Which is the first step that geologists must do to compare rock layers at distant locations? 1.find the absolute age of rocks at
    6·2 answers
  • Commercial utilization of microbial products has become increasingly popular due to their environmentally friendly nature. Remov
    15·1 answer
  • With your fragment now in an expression plasmid, you will need to check to ensure that the fragment is in the correct reading fr
    7·1 answer
  • What percent of a sample of As-81 remains un-decayed after 43.2 seconds
    9·1 answer
  • In ancient times, plant and animal remains got buried, compressed, and transformed into fossil fuels like coal. Burning of these
    11·1 answer
  • Nonpoint sources of pollution a. include smokestacks and automobile exhaust pipes b. are more difficult to control than point so
    13·1 answer
  • 1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
    13·1 answer
  • Are proteins smaller than chromosomes?
    14·1 answer
  • PLEASE HELP ME! ILL GOVE BRAINLIEST
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!