1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
devlian [24]
3 years ago
7

Iron is part of the hemoglobin in red blood cells. what is the purpose of hemoglobin?

Biology
1 answer:
m_a_m_a [10]3 years ago
4 0
The main purpose of hemoglobin is the transport of OXYGEN and CARBON DIOXIDE
You might be interested in
Which of these would not be a VALID scientific theory?
valina [46]
B, as far as we know humans aren't from space
8 0
3 years ago
Read 2 more answers
Discuss negative impact social. Economic. Physical and emotional on myself and community or society at large
s2008m [1.1K]

negative impact for social is that some people tend to be self-consious when out in the public. for physicsl and emotional it is alright but they need to be carfeul when going outdie and ake sure they are hanging out with the right people

4 0
3 years ago
Pollen is produced in structure H through the process of​
Rudiy27

Answer:

Meiosis

Meiosis is the process involved in the production of pollen or male sex cells in an angiosperm flower.

Explanation:

4 0
3 years ago
What is the master switch that determines whether an individual develops as a male?
Inessa05 [86]
<span>In human beings the "master switch" that determines whether an individual will become a male is the SRY gene, which is found on the Y chromosome. The sex-determining region Y protein produced from this gene acts as a transcription factor, meaning it attaches to specific regions of DNA and helps control the activity of particular genes.</span>
6 0
3 years ago
Group translocation is a special _______ transport process across the cytoplasmic membranes of _______.
sasho [114]

Answer:

active; prokaryotes

Explanation:

Active transport can be defined as the movement of molecules across cell membranes against a concentration gradient, i.e., from a region of low concentration to a region of high concentration. Group translocation is a specialized type of active transport observed in prokaryotic cells. In group translocation, the transported substance is chemically modified during its movement, thereby the cell membrane becomes impermeable to this substance once it is within the cell. In bacteria, the phosphotransferase system is a type of group translocation that uses phosphoenolpyruvate (PEP) as a source of energy to transport sugar molecules into the cell.

6 0
3 years ago
Other questions:
  • **!!!NEED HELP?!??!!**** ASAP!!!!
    5·1 answer
  • According to the principle of dominance, _____.
    5·1 answer
  • In pulsus paradoxus, even if the pulse cannot be palpated, it can still be heard by using a BP cuff and stethoscope.
    5·1 answer
  • Is a wildfire caused by an arsonist considered an extreme weather event?
    5·1 answer
  • una persona camina durante una hora y media y corre 4 km con velocidad constante ¿cuál era su velocidad en km/h y en m/s?​
    6·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • The seed plants became dominant during the late ___ when the climate became ___
    5·1 answer
  • What adaptations do tree have in the rainforest?​
    7·2 answers
  • What is the primary advantage of multiple researchers obtaining the same result?
    15·2 answers
  • Explain process of small scale cultivation of mushrooms
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!