A control group of the experiment is the one in which no treatment or intervention is given. So, in your case, the pea plants in which was not subjected any of the fertilizers, will serve as a control group. This is a negative control. A positive control group is the one in which an established treatment is given, which definitely leads to the production of the desired character. So, in your case, a very good well-known fertilizer which has a positive control on the growth of the pea plant, would serve as a positive control.
Due to a genetic modification, a mouse has no horizontal cells in its retinas and it does not expresses the connexin26.
What is horizontal cells?
The horizontal cells has receptive field with the neurobiotin and controlled by the electrical coupling.
Horizontal cells are the laterally interconnecting neurons having cell our bodies withinside the internal nuclear layer of the retina of vertebrate eyes. They assist combine and alter the enter from a couple of photoreceptor cells.
To read more about the horizontal cells refer link :
brainly.com/question/25508290
#SPJ4
Having the haploid number of chromosomes allows the zygote to have the correct number. If gametes weren't haploid, every generation of organisms would have twice as many chromosomes as their parents. I hope my answer has come to your help. God bless and have a nice day ahead!
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
If reproduction didn't exist, all species would eventually go extinct.
