1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
allsm [11]
1 year ago
14

Can someone pls check my answers?? All 5 questions are attached, I got some right but some wrong

Biology
1 answer:
worty [1.4K]1 year ago
6 0

The position of the Earth in the solar system and more regional effects, such as carbon dioxide levels, all play a role in the causes of ice ages. Thus, option A is correct.

<h3>What are factor that involve in ice age on earth?</h3>

When the orbital cycle turns back, these feedbacks—involving the spread of ice and the emission of greenhouse gases—work in reverse to warm the Earth once more.

A prolonged period of cooling of the Earth's surface and atmosphere is known as an ice age, which is marked by the development or presence of polar and continental ice sheets as well as alpine glaciers.

Flooding has increased along the U.S. coastline as a result of the warming, rising, and acidifying of the seas.

Therefore, The Earth is currently facing an ice age.

Learn more about ice age here:

brainly.com/question/12916542

#SPJ1

You might be interested in
Newly formed daughter cells have DNA that is BLANK the parent cell.
Marat540 [252]

Answer:

IDENTICAL

Explanation:

<em>Daughter cells are cells that result from the division of a single parent cell. They are produced by the division processes of mitosis and meiosis. At the completion of the mitotic cell cycle, a single cell divides forming two daughter cells. A parent cell undergoing meiosis produces four daughter cells.</em>

3 0
2 years ago
g Type I diabetes is caused by destruction of the beta cells of the pancreas, the cells that produce insulin. In most cases, the
vodka [1.7K]

Answer:

it is a failure of tolerance (self-tolerance) and specificity (recognition)

Explanation:

Type 1 diabetes is a chronic disease caused by the selective destruction of β cells that are involved in the production of insulin in the pancreas. Type 1 diabetes can be classified into two types: Type 1A diabetes (the immune form of the disease) and Type 1B diabetes (the non-immune form of the disease). Type 1A diabetes is considered an autoimmune disorder where immune responses against pathogens suffer a failure of tolerance to antigens in the β-cells of the pancreatic islets. Thus, Type 1A diabetes is characterized by the process of recognition of β-cell antigens (autoantigens) by the immune system. This disease is often caused by genetic factors associated with mutations in the human leukocyte antigen (HLA) class II region located on chromosome 6.

4 0
2 years ago
*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)​
pogonyaev

Answer:

The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.

Explanation:

Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.

If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:

<u>Exercise 1:</u>

  • DNA    ATACGAAATCGCGATCGCGGCGATTCGG
  • mRNA    UAUGCUUUAGCGCUAGCGCCGCUAAGCC
  • CODON         UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
  • AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
  • Amino acid    Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser

<u>Exercise 2: </u>

  • DNA    TTTACGGCCATCAGGCAATACTGG
  • mRNA    AAAUGCCGGUAGUCCGUUAUGACC
  • CODON         AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
  • AntiCODON  UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
  • Amino acid     Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
3 0
3 years ago
Tim has just jumped out of an airplane. The force of gravity pulls him downward, while air resistance pushes him upward. What is
strojnjashka [21]

Answer:80

Explanation:

the answer is 80 because you just do 705-625= 80

4 0
2 years ago
Read 2 more answers
A mouse running away from the sound of an owl's wings is an<br> example of the mouse's ability to
uysha [10]

Answer:

hear

Explanation:

6 0
3 years ago
Other questions:
  • Why is mendel's law of independent assortment not always valid for two or more phenotypical traits of an individual?
    5·1 answer
  • Most moths of a particular population died when the chestnut blight fungus that they were dependent on got wiped out but some mo
    14·1 answer
  • The Supreme Court rule that police must inform criminal suspects of their legal rights upon their arrest in which case?
    14·2 answers
  • Why is it so important for measurement in experiment to be accurate ?
    13·2 answers
  • Differentiate between pseudoscience and science
    12·2 answers
  • Place the steps of the respiration process in the correct order.
    6·2 answers
  • According to the law of conservation of energy, energy can neither be created nor destroyed. If this is true, why is there less
    11·1 answer
  • What kind of reactions provide a star with energy?<br><br> HELP ME
    5·1 answer
  • 100 POINTS &amp; BRAINLIEST!
    15·2 answers
  • The growth hormone axis contains at least one example of a negative feedback loop.TrueFalse
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!