1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kherson [118]
1 year ago
5

What are the 3 types of substitution mutations?.

Biology
1 answer:
loris [4]1 year ago
5 0

Base substitutions, deletions, and insertions are the three different forms of DNA mutations.

A mutation is a long-lasting alteration to the DNA's nucleotide sequence that can occur during replication and/or recombination. Damaged DNA can change by base pair replacement, deletion, or insertion. The majority of the time, mutations are benign, unless they result in tumor growth or cell death. Cells have developed systems for repairing damaged DNA due to the deadly potential of DNA mutations.

Different Mutations

Base substitutions, deletions, and insertions are the three different forms of DNA mutations.

1. Base Replacements

Point mutations are single nucleotide replacements; you may recall the point mutation Glu ——-> Val is the culprit of sickle cell anemia. There are two types of point mutations, the most prevalent of which are.

Transition and Transversion.

Learn more about Base substitutions using this link:

brainly.com/question/15604401

#SPJ4

You might be interested in
What happens to water molecules during the boiling process
katrin [286]
As a liquid is heated, its molecules absorb heat and move faster. When the liquid starts to boil, bubbles of vapor form within the liquid and rise to the surface. The temperature that causes this to happen is known as the boiling point of a liquid. Which answer choice BEST summarizes the paragraph?
7 0
2 years ago
Function of the rod cells<br>Responsible for vision at low light levels
Darina [25.2K]

Answer:

Rods are responsible for vision at low light levels (scotopic vision). They do not mediate color vision, and have a low spatial acuity. Cones are active at higher light levels (photopic vision), are capable of color vision and are responsible for high spatial acuity. The central fovea is populated exclusively by cones.

5 0
2 years ago
Read 2 more answers
Does the park or the forest have greater biodiversity?
Gennadij [26K]

Answer:

The forests

Explanation:

Forests are so much more than a collection of trees. Forests are home to 80% of the world's terrestrial biodiversity. These ecosystems are complex webs of organisms that include plants, animals, fungi and bacteria. Forests take many forms, depending on their latitude, local soil, rainfall and prevailing temperatures.

3 0
3 years ago
ASAP PLS
mars1129 [50]

Whales have pelvic (hip) bones, which are evolutionary remains from when their forefathers walked on land about 40 million years ago. Common belief has long assumed that such bones are merely vestigial, slowly withering away like human tailbones. Thus option C is correct.

<h3>What is the new research from USC and the Natural History Museum of Los Angeles County (NHM) has to say ?</h3>

New research from USC and the Natural History Museum of Los Angeles County (NHM) contradicts this belief, discovering that not only do those pelvic bones have a role, but their size and perhaps shape are impacted by sexual selection processes.

Therefore, small, shrunken hip bones of whale are no longer beneficial for survival and are considered vestigial. So, the best option is C among the other options available. Thus option C is correct.

Learn more about this here:

brainly.com/question/21492781

#SPJ5

5 0
2 years ago
Read 2 more answers
Please help me with this
Rasek [7]

Answer:

GGCCATAGGTCCCTTTAGCG

Explanation:

I got a 100%

5 0
3 years ago
Other questions:
  • Which statement is true of a placenta?
    10·2 answers
  • Why does the density of liquid water increase as it cools?
    11·2 answers
  • What are some medicinal items from plants?
    15·1 answer
  • 2 Points
    8·1 answer
  • Which of the following occurs after a virus attaches to a host cell in the viral reproduction process?
    15·1 answer
  • Confused if it's option C or D. Plzzz answer quick science q.
    7·1 answer
  • Oil and petroleum are natural resources that are nonrenewable True or false
    14·1 answer
  • Which of the following brain structures is involved in the process of reward and pleasure
    7·1 answer
  • In which of the following would the cell cycle be shortest?
    9·2 answers
  • Name the processes by which carbon dioxide and water move into and out of the cell.
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!