1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
goldenfox [79]
3 years ago
12

20 points help PLEASE!!! Match the following items.

Biology
1 answer:
suter [353]3 years ago
5 0

Answer:

1. intentional learning

deliberately placing information into  your mind

2. chunking

grouping items into smaller segments

3. long-term memory

permanent storage of information

4. encoding

the process of placing information  into the mind

Explanation:

Not too much to explain because those are the definitions.

1. Intentional means on purpose. Deliberate also means on purpose.

2. Chunking is to break into smaller pieces.

3. The long-term memory remember information for the "long-term", almost permanent, (as opposed to the short-term memory).

You might be interested in
In the term semipermeable membrane, what does the prefix mean?
larisa [96]
Anything to do with partial or before
5 0
3 years ago
What roles does estrogen play in the feedback mechanism?
Mademuasel [1]
"Estrogen is involved in a feedback mechanism associated with the follicular phase of menstruation.<span> In a negative feedback mechanism, estrogen released from follicles influences the pituitary gland to decrease the production of follicle stimulating hormone, also known as FSH. In a positive feedback mechanism, rising estrogen causes FSH to increase"
Find out the full answer here~
http://www.ask.com/science/estrogen-play-role-feedback-mechanism-9cc4f9c5050fed0a
</span>
6 0
4 years ago
Read 2 more answers
What happened during interphase?
sasho [114]

Answer:

During interphase, the cell grows and DNA is replicated. ... During interphase, the cell grows and the nuclear DNA is duplicated. Interphase is followed by the mitotic phase. During the mitotic phase, the duplicated chromosomes are segregated and distributed into daughter nuclei.

Explanation:

6 0
3 years ago
Read 2 more answers
Farmer toon soon wanted to start breeding his plants so that they are resistant to disease while producing more fruit per plant.
Damm [24]

Answer:

cultivated plant variety with its wild type variety.

Explanation:

The farmer cross the cultivated plant variety to its wild type which has the characteristics of resistance against diseases. Due to crossing, the offspring produce having resistance against that disease as well as producing high yield. This type of crossing is known as artificial selection in which humans cross two organisms to get the desired characteristics in their offspring so to get a plant with resistance against disease we cross cultivated plant variety to its wild type.

8 0
3 years ago
transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-
tino4ka555 [31]

Answer:

AUGCGCGUAAAGCGGUACUUCUGUAAAUAAGACGAAGAG

Explanation:

this is the complementary strand for the mRNA.

A=U

C=G

G=C

T=A

this is the key for any mRNA strand.

;)

3 0
3 years ago
Other questions:
  • In roses, red flowers and long stems are dominant traits. A rose plant that is homozygous for both red flowers and long stems is
    15·2 answers
  • Know the 5 cardiovascular factors influencing blood pressure?
    9·1 answer
  • Pls help me ASAP I need the answer?!
    11·1 answer
  • Confused.
    7·2 answers
  • All of the following are true of Biotic factors except for ?
    10·1 answer
  • A sac-like organ in birds used for temporarily storing food is a(n) ________.
    7·2 answers
  • All the statements are correct with respect the two atoms placement on the Periodic Table EXCEPT –
    15·2 answers
  • Please help me as soon as you can, thanks!
    9·2 answers
  • If an organism has two different alleles for a trait, it is:​
    13·1 answer
  • All members of Kingdom Protista are ____________ , since their cell(s) possess a nucleus and membrane-bound organelles. Protista
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!