1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ZanzabumX [31]
2 years ago
7

5.What type of nuclear radiation consists of particles having a positive charge?Select one:a. Betab. Alphac. Gammad. Neutron

Chemistry
1 answer:
Nikolay [14]2 years ago
3 0

Explanation:

Alpha radiation (α), also called alpha particles or alpha rays, are particles carried by two protons and two neutrons, thus being helium nuclei. They have a positive charge of +2 and a mass number of 4.

Answer: b. Alpha

You might be interested in
What is thePercent composition of dichlorine heptoxide?
Mandarinka [93]

Answer:

The percent composition of dichlorine heptoxide is 38.76% CI and 61.24% O

8 0
3 years ago
Read 2 more answers
How many neutrons are in Br-85
Travka [436]
There are 45 neutrons
3 0
3 years ago
What are the three was main States of matter?
OleMash [197]

Answer:

liquid, solid, gas

Explanation:

7 0
4 years ago
Read 2 more answers
How many valence electrons does br want. Not have but want.
AnnZ [28]

Answer:

SO the awnser is 76.9 trust me

Explanation:

5 0
3 years ago
Read 2 more answers
If an object that enters the Earth’s atmosphere does not completely disintegrate, its remains can impact the Earth. True or Fals
Alexxandr [17]
The answer is true hope this helps :)
4 0
3 years ago
Read 2 more answers
Other questions:
  • What does an algae cell, tree,mushroom, and animal have in common
    10·1 answer
  • 28.5g of iron shot is added to a graduate cylinder containing 45.50 mL of water. The water level rises to the 49.10 mL , From th
    8·1 answer
  • What number of moles of O2 will be produced by the decomposition of 4.4 moles of water?
    6·1 answer
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • When seeds germinate, roots grow downward and stems grow upward in response to gravity. This response to gravity is called _____
    5·1 answer
  • Why the mass of a rusted nail is greater than the mass of a nail before it rusted ? Explain
    5·2 answers
  • An unknown compound has the following chemical formula:
    14·1 answer
  • Classify each of the following as an element a compound or a mixture ​
    6·1 answer
  • Read the directions and create the graph described below. You will then click the submit button and upload a picture of your gra
    10·1 answer
  • What is the maximum radiation pressure exerted by sunlight in space ( s = 1350 w/m 2) on a flat black surface? a. 2. 25 × 10−5 p
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!