1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
andrezito [222]
1 year ago
8

tructures used in recombinant DNA technology to carry the DNA from the cells of one species to the cells of another species are

Multiple Choice donor DNA. sticky ends. cloning vectors. restriction enzymes.
Biology
1 answer:
Kobotan [32]1 year ago
3 0

The process of fusing two or more DNA molecules to produce a hybrid is known as recombinant DNA. Restrictions endonucleases and ligases are two classes of enzymes that enable the technique.

When a restriction endonuclease detects a particular DNA sequence, it makes cuts inside or near that sequence. The recognition sequence of a restriction enzyme will haphazardly appear on every (1–4)n bases along a random DNA chain. The equation states how many fragments ends (measured in moles) are produced when a restriction enzyme cuts DNA.

Moles of DNA ends =2x(grams of DNA)/(number of bp)(660 g/mol / bp).

The equation describes how many ends are produced when circular DNA is digested by a restriction enzyme.

Mole ends=2x(moles DNA)x number of restriction sites.

The following equation can be used to determine how many ends are produced during the digestion of a linear molecule by a restriction endonuclease.

Mole ends=2x(molesDNA)number of restriction sites +[2x(moles of DNA)].

learn more about DNA brainly.com/question/2131506

#SPJ4

You might be interested in
HELP PLEASE WILL GIVE BRAINLY! <br><br> What is a complementary RNA strand to AGA?
Irina18 [472]

Answer:Problem Set 4 Answers

1a. The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

b. The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’

c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’

(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)

d. The third codon is 5’ ACC 3’.  Therefore, the corresponding anti-codon is 5’ GGU 3’

2. Below is a table for the genetic code:

T

C

A

G

T

TTT Phe (F)

TTC "

TTA Leu (L)

TTG "

TCT Ser (S)

TCC "

TCA "

TCG "

TAT Tyr (Y)

TAC "

TAA Stop

TAG Stop

TGT Cys (C)

TGC "

TGA Stop

TGG Trp (W)

C

CTT Leu (L)

CTC "

CTA "

CTG "

CCT Pro (P)

CCC "

CCA "

CCG "

CAT His (H)

CAC "

CAA Gln (Q)

CAG "

CGT Arg (R)

CGC "

CGA "

CGG "

A

ATT Ile (I)

ATC "

ATA "

ATG Met (M)

ACT Thr (T)

ACC "

ACA "

ACG "

AAT Asn (N)

AAC "

AAA Lys (K)

AAG "

AGT Ser (S)

AGC "

AGA Arg (R)

AGG "

G

GTT Val (V)

GTC "

GTA "

GTG "

GCT Ala (A)

GCC "

GCA "

GCG "

GAT Asp (D)

GAC "

GAA Glu (E)

GAG "

GGT Gly (G)

GGC "

GGA "

GGG "

a. The following codons can be mutated by one base to produce an amber codon:

CAG    Gln

AAG    Lys

GAG    Glu

TCG    Ser

TTG    Leu

TGG    Trp

TAA    Stop

TAT    Tyr

TAC    Tyr

b. From part a, CAG (Gln) and TGG (Trp) can become amber stop codons through EMS.

c. From part b, both of the resulting amber codons could be suppressed by amber nonsense suppressors generated by EMS.

3a. The codon is the three nucleotide sequence in the mRNA that indicates which amino acid should be incorporated in the growing polypeptide chain.  The anticodon is the complementary three nucleotide sequence in the appropriate tRNA.

b. Template strand is the DNA strand off which the mRNA is synthesized.  The coding, or non-template, strand is the DNA strand complementary to the template strand; it has the same sequence (except for T for U substitutions) as the mRNA.

c. The Pribnow box is a sequence of six nucleotides (TATAAT) positioned at -10 that signals where transcription initiation should begin in prokaryotic DNA.  The Shine-Delgarno sequence is a short, purine-rich region in the mRNA that is complementary to the rRNA within the 16S ribosomal subunit.  The sequence signals which AUG acts as the translation start in mRNA.

4a. False, a wobble allows the anticodon in the tRNA to hybridize with different codons in mRNA.

b. False, a frameshift mutation affects all the subsequent amino acids.

c. False, only one codon (AUG) encodes for the start of protein synthesis; three codons signal the end of protein synthesis.

d. False, the wobble is first base (5’ to 3’) in the anticodon.

e. True, RNA can be used as a template for DNA synthesis in a process known as reverse transcription.

f. True.  For example, a single base substitution causing CAT to change to AAT would signal a termination.

g. False, the Wobble Hypothesis explains how alternate base pairing can occur with the first nucleotide (going from 5' to 3') in the anticodon.

5a. Digestion of RNA with alkali will cleave the strand after each 3’ phosphate.  Therefore, the products remaining will consist of pppNp, Np, and N-OH

b. If RNA was synthesized in the 3’ to 5’ direction (i.e. by adding ribonucleotides to the 5’ end), then the pppNp and Np fragments should be labeled with tritium.

c. If RNA was synthesized in the 5’ to 3’ direction (i.e. by adding ribonucleotides to the 3’ end), then the Np and N-OH fragments should be labeled with tritium.

d. Since the N-OH fragments were labeled with tritium, RNA synthesis must occur in a 5' to 3' direction.

6. In a missense mutation, the new nucleotide alters the codon so as to produce an altered amino acid in the protein product.  With a nonsense mutation, the new nucleotide changes a codon that specified an amino acid to one of the stop codons (TAA, TAG, or TGA). Therefore, translation of the messenger RNA transcribed from this mutant gene will stop prematurely.

Explanation:

5 0
2 years ago
Intervertebral discs are made up of fibrocartilage, which exhibits a large amount of tensile strength, enabling it to absorb sho
Vika [28.1K]

Answer:

Collagen fibers

Explanation:

Cartilage is the connective tissue found in the mammalian group of animals and is composed of the collagen fibre made by the chondrocytes which occur at the scattered sites.

The fibrocartilage is one of the types of cartilage present in the intervertebral disks and helps provide the tensile strength and help absorb the shock in the spine.

The extracellular matrix of fibrocartilage is enriched with the collagen fibres which provides toughness and great tensile strength to the cartilage.

Thus, Collagen fibres are the correct answer.

3 0
3 years ago
What are functions of protein
katen-ka-za [31]

For example, enzymes are proteins that speed up chemical reactions in the body and hormones, like insulin, are proteins that regulate the activity of cells or organs. Some proteins transport materials throughout your body, such as hemoglobin, which is the oxygen-transporting protein found in your red blood cells

7 0
3 years ago
Read 2 more answers
What is the formula to solve for mass in specific heat capacity?
Setler79 [48]
Quantity of Heat = Mass x Heat Capacity x Temperature Change 
This may be shortened to: 
q = mcΔT 
where: 
q = Quantity of heat in Joules (J) m = Mass of the substance in grams (g) c = Specific Heat Capacity (Jg-1) ΔT = Change in Temperature (Δ = This symbol is "delta", which is Greek for "change") 
8 0
3 years ago
A person you are helping is awake and alert but is complaining of a severe headache, pain in their abdomen and nausea. you obser
Zinaida [17]
There are choices for this question namely:

a. What is your name and where do you live?
b. How much poison did you swallow?
c. How long have you been feeling this way?
<span>d. What have you recently had to eat or drink?
</span>
The correct answer is "what have you recently had to eat or drink". This will confirm the suspicion by first ruling out potential reactive foods or drinks that may have caused a similar reaction (i.e. allergic reactions). If that is ruled out, then the probing about the history of intake of poison will come next in the interview. 
6 0
2 years ago
Other questions:
  • Monomers are joined together by _______ to form polymers. polymers are broken down into monomers by _______.
    11·1 answer
  • Adenosine triphosphate (atp) is the main \"energy currency\" used in cells. atp hydrolysis is coupled with unfavorable reactions
    13·1 answer
  • How many electrons would be in the outer shell of an atom of phosphorous?
    5·2 answers
  • How are tumor cells different from normal cells?
    7·1 answer
  • Enzymes are important to metabolic reactions of the cell in which of the following ways?
    15·1 answer
  • There are five basic types of emergencies that every hunter should know about. which emergency is listed here?
    5·2 answers
  • The main immediate source of atp (lasting about 10 seconds) as muscle contractions begin comes from
    13·1 answer
  • A wealthy businessman uses modern DNA technology to bring dinosaurs back from extinction. He breeds many varieties of dinosaurs
    5·1 answer
  • At what depth below sea level do you begin to observe evidence of tectonic<br> activity
    13·1 answer
  • Where are cell-free ribosomes found?
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!