All categories

2 years ago

How many chromosomes would a cell have after mitosis if it has 24 chromosomes during interphase?

1 answer:

Volgvan2 years ago

6 0

If a cell has 24 chromosomes during interphase then after mitosis or mitotic division it will have 24 chromosomes.

Interphase is the resting phase between successive mitotic divisions of a cell, or between the first and second divisions of meiosis.

Mitosis or mitotic division is a type of cell division that results in two daughter cells each having the same number and kind of chromosomes as the parent nucleus, typical of ordinary tissue growth.

If a cell has 24 chromosomes during interphase then the daughter cell resulting from mitotic division or mitosis will have 24 chromosomes.

To know more about chromosomes:

brainly.com/question/1208885

You might be interested in

Autoimmune diseases occur when the immune system fails to recognize and tolerate ____________ antigens.

Dahasolnce [82]

Answer:

Harmful

Explanation:

When you have an autoimmune disorder, your immune system does not distinguish between healthy tissue and potentially harmful antigens.

6 0

3 years ago

AUUUAACUGUUCUGUCUAGAG

Lana71 [14]

Answer: three sets: ile. leu,phe,cys,leu,glu. glu,ile,cys,leu,val,asp,leu

The most likely sequence to be included is the R to L read, because of the STOP codon if read L to R. The lone ile would be the last amino acid of a different polypeptide, and there is no promoter sequence after the STOP codon.

Explanation:

auu,uaa,cug,uuc,ugu,cua,gag

Ile,STOP,leu,phe,cys,leu,glu

glu,ile,cys,leu,val,asp,leu (reverse)

After a STOP codon, a DNA promoter is required

5 0

3 years ago

Can someone please answer 15-17

yan [13]

Answer:

15. D have specific gened activated

16. G cell division is unregulated

17. D providing information to form proteins

Explanation:

15. When an egg is first fertilised, the cells are very flexible. They are sort of like a "blank slate", and can become any type of cell. From these cells, all the cells in the body are created: brain cells, skin cells, blood cells etc. To become all these different types of cells, they keep dividing, slowly branching off and becoming more specific. This process is called differentiation.

They do this because different patterns and combinations genes are activated that turn them in to these different and specific cell types.

16. One of the hallmarks of a cancer cell is unregulated cell division. Oncogenes start as normal genes (called proto-oncogenes) that function in normal processes, such as the cell cycle, inhibiting apoptosis. However, when they become mutated, they can promote the growth and division of cells and prevent their programmed death. This is because they become more active or present in higher amounts following the mutation. This causes such functions in the cell to become deregulated, leading to uncontrolled cell proliferation and the growth of harmful tumour cells.

17. The central dogma of biology states that DNA --> RNA --> protein. The messenger RNA (mRNA) is transcribed from the DNA. It contains a message that is translated by the protein synthesis machinery to form proteins.

This is how all the proteins in the cell are produced, and the information for how to encode them is entirely dependent upon the sequence of the DNA, which is sent as a coded message in the form of RNA, to the protein synthesis machinery. The protein synthesis machinery makes the proteins according to the DNA sequence (as translated from the mRNA).

3 0

3 years ago

Jane is observing the Milky Way thanks to the fact that it is a very clear, dark night. However, she feels like she can only see

anygoal [31]

Answer:

Because of her position within it.

Explanation:

It's visible just so long as the sky is clear and the light pollution is minimal.

7 0

3 years ago

What is the relationship between waves and amount of energy in the electromagnetic spectrum ?

Andreyy89

I believe it’s a, as the waves increase the infrequently decreases

3 0

3 years ago