Which do you think is more important? - nature (genes) or nurture (environment)

Biology

1 answer:

alexdok [17]2 years ago

4 0

Answer:

Nature.

Explanation:

Nature is more important than nurture because genes determine who we are. But our environment influences us, genes determine how it affects us. For this reason, nature is more important than nurture

You might be interested in

Please Help (will give brainly)

Vaselesa [24]

C is the answer.We are using to classify organisms beyond molecular setting not by the physical structure.note-applicable for this question only

4 0

3 years ago

Read 2 more answers

Which of the following is a function of body fat? a. It is an important component of teeth. b. It is a source of some hormones.

labwork [276]

Answer:

Explanation:

3 0

3 years ago

BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I

storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

3 0

3 years ago

In landscapes dominated by low-infiltration capacity, what is the first step in erosion?

Oksana_A [137]

Low infiltration capacity means that the soil cannot absorb much water per volume. The first step in erosion in a landscape dominated by low-infiltration capacity is the raindrop splash. This is where raindrops displace the soil from their original place because the soil cannot absorb adequate amounts of water.

3 0

3 years ago

Regulation of isoleucine synthesis is an example of feedback inhibition of an anabolic pathway. With that in mind, explain how A

Pepsi [2]

Answer & Explanation:

Feedback is a form of regulation where the main product of one reaction, can also inhibit it. It can work in several ways, mainly there's a receptor that, somehow, measures the presence of a determined molecule, in this case, ATP. These receptors can also be involved in the metabolic process and when there's an excess of ATP, the enzymes are inhibited, maybe with an allosteric type of inhibition.

3 0

3 years ago