1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
meriva
1 year ago
12

The German Cockroach is more closely related to the American Cockroach than it is to the Desert Cockroach.

Biology
1 answer:
Mnenie [13.5K]1 year ago
6 0

German roaches have flat bodies with six legs, two antennae projecting from their heads, and flat bodies, just like their American cousins and other cockroach species. Contrarily, American cockroaches are typically reddish-brown in appearance and develop to a length and width of around an inch and a half.

<h3>What is Cockroach?</h3>

Cockroaches are an insect paraphyletic category that includes all Blattodea members with the exception of termites. Only about 30 of the 4,600 cockroach species have any connection to habitations by people. Some species are infamous for developing pest problems.

To learn more about Cockroach visit:

brainly.com/question/17283807

#SPJ4

You might be interested in
Consider two soil samples one from a tropical rain forest and the other from a temperate deciduous forest. Predict which sample
Finger [1]

Answer:

Temperate deciduous forest

Explanation:

rain forest soil is highly acidic as its what trees there rely on for absorbing nutrients. The type pf clay present there also has poor ability to trap nutrients so they usually get washed away. Its almost the opposite for deciduous forests.

7 0
3 years ago
These are submarine mountains.
prohojiy [21]
What do you need help with hun
5 0
3 years ago
List the two stages in photosynthesis<br> a.____________ b.____________
tekilochka [14]
Its <span> light-dependent reactions and the Calvin cycle.

hope this helps you</span>
4 0
3 years ago
Mycoplasma mycoides is of particular interest because:
Mnenie [13.5K]

Answer: It has multiple nuclei, It is one of the smallest of cells with among the smallest of genomes.

Explanation:

Mycoplasma mycoides is a bacterial strain of the genus Mycoplasma. It belongs to the class of Mollicutes. This is parasitic in nature. It lives in the ruminants.  It is smallest known bacteria that does not posses the cell wall. It is present everywhere as a pathogen. It's function is to interfere with the ability of the virus to affect the mammalian cells. It posses multiple nuclei.

It is smallest free-living single celled organism. Due to the small size the entire genome can be sequenced. It can be useful for purpose of research and it is of particular interest because of it's small cell size and multiple nuclei. It serves as a model organism to study the bacterial evolution.

7 0
3 years ago
Cellulose is a complex carbohydrate found in cell walls of plants. What is the function of cellulose in a plant cell
mote1985 [20]

It is what makes plant stems, leaves, and branches so strong.

5 0
3 years ago
Read 2 more answers
Other questions:
  • scientists discovered bacteria inside one of the returned pieces of Surveyor 3 What are some possible explanations for this surp
    13·1 answer
  • Activation energy is
    8·2 answers
  • What does selectively permeable membrane mean
    5·2 answers
  • How are particle like dancers
    5·1 answer
  • Who is most likely to be infect ?why?
    12·1 answer
  • How many chromosomes do humans have in each cell?
    13·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • Show the energy of one molecule of glucose.
    8·1 answer
  • Please help me please!!<br> (Picture above)
    7·1 answer
  • What about this fungus and Brazilian ant makes it a parasitic relationship?<br>​
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!