1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sedbober [7]
3 years ago
9

A cardiologist provided an interpretation and report of an ekg. what cpt® code is reported?

Biology
1 answer:
Gnesinka [82]3 years ago
8 0

CPT 93010  is the code for the EKG, which is routine electrocardiogram, with interpretation and report only.  

The EKG or ECG refers to the Electrocardiogram. The Electrocardiogram is a test done for the measurement of the heart’s electrical activity. This test is a non invasive test, which can help in the identification of many heart problems. This test is also performed for the routine checkup of the heart.  


You might be interested in
Dggggggggggggggggggggggggggggggggggggggggggggggg
Nata [24]
Thank you so much for the points I hope you have a wonderful day
4 0
2 years ago
It is the _____________ of climate that makes it so important.
babymother [125]
It is the regularity of climate that makes it so important.
3 0
3 years ago
Read 2 more answers
a) ¿Qué utensilios de uso común y pensando en la contingencia sanitaria, podrían ser elaborados del cobre?
forsale [732]

Answer:

Hierro fundido.

Acero inoxidable.

Vidrio.

Bambú.

Cerámico.

quizás

Explanation:

4 0
3 years ago
Pls pls pls help!! i will make brainliest!!
Andrews [41]

1. RNA

2. Nucleic acid.

3. Units.

4. DNA.

5. Protein.

6. Transcription

7. Molecules

8. Units

9. Amino acids.

10. Translation.

<h3><u>Explanation:</u></h3>

Protein synthesis and the RNA synthesis is the total process that takes place together in each and every cell which is the Central Dogma theory.

In this theory, the RNAs are produced from the DNA by means of the process of transcription. In this process, the enzyme DNA dependent RNA polymerase acts as the primary DNA.

In the second step, the RNA produces the protein by the process of translation. This process involves the participation of each and every types of RNA like the rRNA, tRNA, and mRNA. These RNAs are all involved to form proteins by accumulation of amino acids and polymerizing them to form proteins.

8 0
3 years ago
if you were having a problem converting food to energy which the system might you want to have checked
OLEGan [10]
The person should have his or her thyroid gland tested using a blood test of thyroid hormone levels to find out if the person has hypothyroidism.
6 0
3 years ago
Read 2 more answers
Other questions:
  • How can you obtain a cells ratio of surface area to volume?
    14·2 answers
  • What was one characteristic of a New England colonial town?
    8·1 answer
  • Number of species in archaebacteria
    14·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • Identify the letter of the food that contains high amounts of proteins.
    14·1 answer
  • What are the three forms of plague and how are they contracted?
    5·1 answer
  • Something that consists of a star and all of the bodies in orbit around it is called ?
    6·2 answers
  • Jezelyn needs to create a project that shows geographic isolation in action and decides to make a video. Which of the following
    7·1 answer
  • Lymphedema is a disorder in which the lymphatic vessels associated with capillary beds are blocked. What will be the long-term e
    5·1 answer
  • Brown et al. and Morwood et al. reported in 2004 that they had found skeletal remains of a previously unknown type of hominin, n
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!