1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ludmilkaskok [199]
3 years ago
10

What is a very poisonous substance. for mammals. LOTS OF POINTS

Biology
2 answers:
zlopas [31]3 years ago
7 0
A snake's Venom can be, but I'm not sure if you're looking for something specific.
Zanzabum3 years ago
3 0
Cyanide.

It stops the break down of hydrogen peroxide; a toxic metabolic waste. When the hydrogen peroxide accumulates, it can corrode the muscles and tissues in a mammal's body. The enzyme catalase breaks down hydrogen peroxide into water and oxygen. Cyanide is the enzyme inhibitor of catalase.

Hope this helps!
You might be interested in
The experiment that Stanley L Miller and Harold C Urey conducted regarding the origin of life from inanimate matter was conducte
nignag [31]
For giving you understanding ; we need Free O2 but Oxygen is also available in H20 right why dont we use it !!

As the early atmosphere was reducing as there was no free oxygen but it was later produced by chemoautotrophic bacteria !! Living thing release O2 in atmosphere thus making it oxidising in nature and then life evolves !!
4 0
3 years ago
Read 2 more answers
Here’s part b of what I asked before
dedylja [7]

Explanation:

All cells have a plasma membrane, ribosomes,and DNA. The plasma membrane, or cell membrane, is the phospholipid layer that surrounds the cell and protects it from the outside environment. They both use ribosomes for producing proteins.

+sorry i made a mistake on the previous question. Prokaryotic cell doesn't have nucleus. I obviously didn't know the right meaning of this word bc im not a native english speaker

6 0
3 years ago
In the future, phylogenetic studies should be conducted to ________. In the future, phylogenetic studies should be conducted to
Artist 52 [7]

Answer:

a. resolve the branching patterns (evolutionary history) of the Lophotrochozoa

b. (the same, it is repeated)

Explanation:

Nemertios (ribbon worms) and foronids (horseshoe worms) are closely related groups of lofotrocozoa. Lofotrocozoans, or simply trocozoans (= tribomastic celomados with trocophoric larva) are a group of animals that includes annelids, molluscs, endoprocts, brachiopods and other invertebrates. They represent a crucial superphylum for our understanding of the evolution of bilateral symmetry animals. However, given the inconsistency between molecular and morphological data for these groups, their origins were not entirely clear. In the work linked above, the first records of genomes of the Nemertine worm Notospermus geniculatus and the foronid Phoronis australis are presented, along with transcriptomes along the adult bodies. Our phylogenetic analyzes based on the genome place Nemertinos as the sister group of the taxon that contains Phoronidea and Brachiopoda. It is shown that lofotrocozoans share many families of genes with deuterotomes, suggesting that these two groups retain a common genetic repertoire of bilaterals that do not possess ecdisozoans (arthropods, nematodes) or platizoos (platelets, sydermats). Comparative transcriptomics demonstrates that foronid and brachiopod lofophores are similar not only morphologically, but also at the molecular level. Although the lofophore and vertebrates show very different cephalic structures, the lofophorees express the vertebrate head genes and neuronal marker genes. This finding suggests a common origin of the bilaterial pattern of the head, although different types of head will evolve independently in each lineage. In addition, we recorded innate immunity expansions of lineage-specific and toxin-related genes in both lofotrocozoa and deuterostomes. Together, this study reveals a dual nature of lofotrocozoans, in which the conserved and specific characteristics of the lineage shape their evolution.

8 0
3 years ago
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
What is the definition of a asexual human
Dmitry [639]

Answer:

the lack of sexual attraction to others, or low or absent interest in or desire for sexual activity. It may be considered a sexual orientation or the lack thereof.

Explanation:

7 0
4 years ago
Other questions:
  • Shortly after the zygote is formed, it begins the processes of duplication and division. each resulting new cell has:
    15·1 answer
  • What is stored in carbon bonds
    14·1 answer
  • Vinegar has a density of 1.01 g/mL and freezes at approximately 2°C (36°F). It has a sour taste and is often used to make pickle
    11·1 answer
  • Use co-dominance to solve. Cross a roan (red and white) cow and a white
    9·1 answer
  • What is one of the main functions of the nucleus of an animal cell? It is the place where energy is produced for the animal. It
    14·1 answer
  • Where does each chromosome in a pair of homologous chromosomes come from ORIGINALLY?
    11·1 answer
  • Give one use of sugar in the body
    7·2 answers
  • Opp- Nevermind I found the answer = w =
    14·1 answer
  • What advantage does a reliable web page have over published textbooks and
    5·2 answers
  • Essay help please? Animal systems class
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!