1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mr Goodwill [35]
3 years ago
7

The ecological relationship between largemouth bass and whirligig beetles is best described as:

Biology
1 answer:
oksian1 [2.3K]3 years ago
6 0
Predator-prey will be your answer
You might be interested in
When two parents join to form a new individual-
Zolol [24]

Answer:

"B"

Explanation:

It will have both traits from both parents.

7 0
2 years ago
Which level of Ecology explores the relationships among different species and the environment?
vichka [17]

Answer:

I an expert in Biology, trust me.

I an expert in Biology, trust me.Your answer is<em><u> </u></em><em><u>Ecosystems</u></em><em><u>.</u></em>

<u>Explanation:</u>

<em><u>An ecosystem is a geographic area where plants, animals, and other organisms, as well as weather and landscape, work together to form a bubble of life. Ecosystems contain biotic or living, parts, as well as abiotic factors, or nonliving parts.</u></em>

<em><u>If</u></em><em><u> </u></em><em><u>you</u></em><em><u> </u></em><em><u>like</u></em><em><u> </u></em><em><u>my</u></em><em><u> </u></em><em><u>answer</u></em><em><u> </u></em><em><u>you</u></em><em><u> </u></em><em><u>can</u></em><em><u> </u></em><em><u>mark</u></em><em><u> </u></em><em><u>my</u></em><em><u> </u></em><em><u>answer</u></em><em><u> </u></em><em><u>as</u></em><em><u> </u></em><em><u>Brainliest</u></em><em><u>.</u></em>

<em><u>And</u></em><em><u> </u></em><em><u>if</u></em><em><u> </u></em><em><u>you</u></em><em><u> </u></em><em><u>have</u></em><em><u> </u></em><em><u>any</u></em><em><u> </u></em><em><u>questions</u></em><em><u> </u></em><em><u>do</u></em><em><u> </u></em><em><u>not</u></em><em><u> </u></em><em><u>hesitate</u></em><em><u> </u></em><em><u>to</u></em><em><u> </u></em><em><u>ask</u></em><em><u>.</u></em>

8 0
2 years ago
An individual heterozygous for the A and B alleles has a blood type of AB. What type of inheritancepattern is this?
Inga [223]

The correct option is the first one "Codominance", since both alleles are expressing at the same time.

8 0
1 year ago
Why will salivary amylase not break down protein
Free_Kalibri [48]
Salivary amylase is an enzyme that is found in saliva in the mouth. It is an enzyme that only recognizes the glycosidic bonds between molecules of simple sugars that form the carbohydrate polymers. It specifically targets these bonds and breaks them and does not recognize any other bonds of different substances such as protein. Salivary amylase is alkaline in nature and cannot work in the stomach. It breaks the glycosidic bonds between the glucose molecules in starch to form maltose. Maltose is later broken down further by pancreatic amylase, into individual units of glucose.
6 0
3 years ago
Which would be a adaptation for a living in the tundra
Leno4ka [110]

two adaptions would be hibernation and migration

8 0
3 years ago
Read 2 more answers
Other questions:
  • One effect of decreasing wolf populations in north america is:
    10·1 answer
  • The major site of photosynthesis in plants occurs in
    9·1 answer
  • The polar head of a phospholipid is made of _______ molecules.
    9·1 answer
  • HELP I need the answer quick!!! The atomic number of an atom is the number of _______? A)protons and neutrons B)neutrons C)elect
    6·2 answers
  • What is a passage followed by magma in a volcano
    8·1 answer
  • Examine the model representing levels of organization in living things.
    9·2 answers
  • ______ DNA is held within the cell's nucleus.
    15·2 answers
  • Why is oxygen atom of one water molecule attracted to hydrogen atom of another water molecule?
    9·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • What ia dark matter​
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!