1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Viefleur [7K]
2 years ago
9

What is the primary product of light-independent reactions? B. high energy fats.....?

Biology
1 answer:
pentagon [3]2 years ago
3 0
High energy sugars an example is glucose 

You might be interested in
The term for energy of movement
lara31 [8.8K]

Answer;

-Kinetic energy

Explanation;

The energy associated with motion or movement is called kinetic energy.

-Kinetic and potential energies are found in all objects. If an object is moving, it is said to have kinetic energy (KE). Potential energy is stored energy and the energy of position; gravitational energy.

-An object that has motion - whether it is vertical or horizontal motion - has kinetic energy. Kinetic energy is calculated by the formula 1/2mv², where m is the mass of the object and v is the velocity of the object.

-Therefore, kinetic energy depends upon two variables: the mass (m) of the object and the speed (v) of the object.


5 0
3 years ago
What are some tips for handling a raccoon​
kondor19780726 [428]

Answer: If it comes closer, make yourself look larger and make lots of noise. If it still continues to come closer then spray (or throw) water at it. A raccoon that is too aggressive or too tame may be sick or injured.

8 0
3 years ago
In what way does the nervous system connect to the skeletomuscular system?
Levart [38]

C. The nervous system sends signals to make muscles move.

3 0
2 years ago
Skeletons of early vertebrates were composed of cartilage instead of bone. Which characteristic does cartilage share with notoch
dsp73
I think B correct me and report me if I'm wrong.
7 0
2 years ago
Read 2 more answers
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
3 years ago
Other questions:
  • What are 3 categories of causes for cancer?
    15·1 answer
  • SOMEONE PLEASE HELP ME :(
    9·2 answers
  • Identify a cell and 3 list 3 reasons why i know this to be true
    9·1 answer
  • Microscopic fossils, or ______________, of single celled prokaryotic organisms that resemble modern bacteria have been found in
    9·1 answer
  • Yeast cells obtain energy under anaerobic conditions through the<br> process of...
    12·1 answer
  • HELP FAST !! 20 p. When matter evaporates or boils, both processes end up with the same result.
    11·1 answer
  • According to cell theory where do plant cells come from
    13·2 answers
  • When you do rigorous exercise, the cells of the muscles require more oxygen. Which condition ensures this requirement is met?
    11·1 answer
  • How do primary air pollutants differ from secondary air pollutants
    8·1 answer
  • The process in which substances enter the cell without the use of energy is called
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!