1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tatuchka [14]
3 years ago
14

An increase in the greenhouse effect, increases the production of what gas?

Biology
1 answer:
jeka57 [31]3 years ago
7 0

The green house effect is a natural process that warms the Earth surface.

((Carbon dioxide))

You might be interested in
To which phylum would a flowering plant that produces seeds belong?
k0ka [10]
A flowering plant that produces seeds belong to <span>Angiosperms as its phylum.</span>
4 0
3 years ago
Which molecule is a high energy output of photosynthesis
Mademuasel [1]
I think it’s ATP I searched it
6 0
3 years ago
Need help ASAP! Will give brainliest;) NO LINKS please, WILL REPORT.
Ivenika [448]

Answer:

d horse ,................................ I think

5 0
3 years ago
What is consumed by producers
denpristay [2]

Answer:

the materials to make the product

7 0
3 years ago
What<br> are<br> quantative traits reffered to?
zaharov [31]

Answer:

A quantitative trait is a measurable phenotype that depends on the cumulative actions of many genes and the environment.

Explanation:

These traits can vary among individuals, over a range, to produce a continuous distribution of phenotypes. Examples include height, weight and blood pressure.

7 0
2 years ago
Other questions:
  • Chemical bonds that involve the total transfer of electrons from one atom or group of atoms to another are called
    5·1 answer
  • What is the complementary strand to ATTCGGTGC
    13·1 answer
  • The forest ecosystem is a living resource.<br> a. True<br> b. False
    7·1 answer
  • Plant cells and animal cells were observed under a microscope. The characteristics of two cells are listed below.
    6·2 answers
  • What is the function of oxygen in the human body? In other words why do we need<br> lit?/?
    11·1 answer
  • Tatem is a low birth weight neonate who now has longer periods of sleep, cries less, and has gained weight much faster than othe
    13·1 answer
  • What do cells need to live and move
    14·1 answer
  • What is the complementary DNA of TACCGGATGCCAGATCAAATC?
    10·1 answer
  • In which direction is the wind likely to blow in the picture?
    14·2 answers
  • Why must transcription occur where dna can be found.
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!