1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
elena55 [62]
2 years ago
5

Help!

Biology
1 answer:
KatRina [158]2 years ago
6 0
The last one is false, the plates are almost always moving
You might be interested in
The function of beta-galactosidase is to ______.
kiruha [24]
The answer to the question is the letter "A" Breakdown glucose.

The function of beta-galactosidase is to break down glucose. This beta-galactosidase is also commonly called "Beta-gal". This enzyme breaks down the glycosidic bond, it also includes carbohydrates that contain glucose.
5 0
3 years ago
The left side of the brain controls the left side of the body
Ivahew [28]

Answer:

The left side of the brain is responsible for controlling the right side of the body. It also performs tasks that have to do with logic, such as in science and mathematics. On the other hand, the right hemisphere coordinates the left side of the body, and performs tasks that have do with creativity and the arts.

Explanation:

Hope this helps

7 0
3 years ago
Definition of transpiration in the water cycle
UNO [17]
Transpiration<span> is the process which moisture is carried through plants from roots to small pores on the under part of leaves, where it changes to water vapor and is released to the earth. </span>Transpiration<span> is essentially evaporation of </span>water<span> from plant leaves.</span>
7 0
3 years ago
A person eating in an asian restaurant has just finished a meal and immediately experiences burning and flushing of her skin and
Harrizon [31]
The appropriate response is Monosodium Glutamate. Unadulterated MSG is accounted for to not have a wonderful taste to the point that it is joined with an exquisite fragrance. The fundamental tactile capacity of MSG is credited to its capacity to upgrade flavorful taste-dynamic mixes when included the best possible concentration. The ideal fixation differs by nourishment; in clear soup, the joy score quickly falls with the expansion of more than one gram of MSG for each 100 mL.
5 0
3 years ago
sequence 1 has a blank muation original: ATCGCCGGAATAGGCATCAGCAGT SEQUENCE 1: ATCGCCCGAATAGGCATCAGGAGT
Nonamiya [84]

Answer:

interesting

Explanation:

I love this, good job. Have a great day :))

4 0
2 years ago
Other questions:
  • What conditions cause the contractile vacuole to fill with water?
    9·2 answers
  • How many deciliters are in 8.12 decaliters?
    8·2 answers
  • What was the purpose of the apollo space mission
    12·2 answers
  • Why would wearing sunscreen help prevent melanoma
    13·2 answers
  • The ________ sphincter, or valve, controls food movement from the stomach into the small intestine.
    13·1 answer
  • The energy required for the mechanism of active transport comes from
    14·1 answer
  • Which component of the type a behavior pattern best explains the connections between the type a profile and heart disease?
    14·1 answer
  • Meanings for A.carbohydrates B.fibres C. balanced D. diet E. proteins F. fat G.constipation​
    5·1 answer
  • What type of muscle tissue is on the chicken wing
    7·2 answers
  • What kind of relationship does mistletoe<br> have with the oak tree? Explain your answer.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!