1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
AysviL [449]
2 years ago
15

What scientific evidence would show that two species of birds are closely related? Question options:

Biology
2 answers:
DaniilM [7]2 years ago
7 0
The two bird species have similar DNA sequences
solmaris [256]2 years ago
4 0
The two bird species have similar DNA sequences
You might be interested in
BRAINLIESTTT ASAP!!!!
Over [174]

When the cells undergo late apoptosis, the membrane structure is destroyed and the nuclear structure can be selectively visualized by Hoechst 33342/PI.

https://www.creative-bioarray.com/support/double-staining-apoptosis-assay-hoechst33342-pi.htm

4 0
2 years ago
Proteins that speed up chemical reactions in the body are called:
hichkok12 [17]
They're called Enzyme. They're made up of proteins. They act as a biological catalysts that can speed up chemical reaction. They have an active site that certain substrates binds into it and form a product. Enzyme works under optimum pH and temperature and the active sites are not changed unless denatured.
7 0
2 years ago
Which of the following is a characteristic of monopolistic competition?
sp2606 [1]
Free entry is going to be your answer
6 0
3 years ago
9. Consider the below Punnett square cross. Explain how you could use it to determine which parent
kogti [31]

Answer: The father determines the biological sex of a baby

Explanation: Human beings have two sex chromosomes, males have XY chromosomes whereas females have XX chromosomes. During fertilization, an egg from a woman fuses with a sperm cell from a man to form a zygote. Women have two X chromosomes (XX) and any point in time they can only release an egg bearing an X chromosome but males have one X and one Y chromosome, therefore they can either release a sperm cell with an X chromosome or a sperm cell with a Y chromosome. When an egg with X-chromosome fuses with a sperm cell with an X chromosome, the resulting baby is a female but when an egg with an X chromosome fuses with a sperm cell with a Y chromosome, the resulting baby is a male.

What makes the difference in both sexes is the Y chromosome from the man, therefore the father determines the biological sex of a baby.

3 0
2 years ago
Individuals with one form of lactose intolerance do not produce the
Tema [17]

Answer: Transcription - A

Explanation:

This problem is talking about the lac operon and the gene expression of lac operon. If the gene is turned off, then transcription, the generation of mRNA won't occur.

6 0
2 years ago
Other questions:
  • Unlike cones, rods
    7·2 answers
  • Select all that apply. Which of the following factors determine conditions in a biome? population density temperature carrying c
    10·2 answers
  • Consider the role of fire in a forest. compare and contrast the consequences of high-frequency versus low-frequency fire, and hi
    8·1 answer
  • Which might be a cause for the increase in songbirds at the feeders?
    8·2 answers
  • What is the importance of plants in social life in Humans
    11·1 answer
  • What structure do all vertebrae embryos contain
    10·1 answer
  • .Proteins can be visualized in many ways, each of which highlights a specific aspect of the protein. Drag the terms on the left
    10·1 answer
  • Although carbon dioxide emissions are reduced, geothermal power plants release odor pollution that smells like rotten eggs. True
    9·2 answers
  • wind and water are both inderect forms of? Solar energy? Mechanical energy? electrical energy? geothermal energy?
    7·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!