1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
allochka39001 [22]
3 years ago
8

Que es el estudio demografico

Geography
1 answer:
Sati [7]3 years ago
8 0

Answer:

Es el estudio de poblaciones humanas.

Explanation:

You might be interested in
Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA
Rina8888 [55]

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

7 0
3 years ago
Where do most earthquakes occur?
Sladkaya [172]
The answer is b 

add me as best answer 
3 0
3 years ago
What observation about this mid-ocean ridge diagram below was used to support Wegener's hypothesis of continental drift?
nata0808 [166]

Answer:

Tectonic plates

Explanation:

is a theory that explains the way the coldest and stiffest outer portion of the lithosphere is structured on Earth

5 0
3 years ago
How does reclamation protect the environment around a mine??
Dovator [93]
To be basic, it harnesses the greenery. So it prevents the greenhouse emissions from harming any greenfields from becoming brownfields
8 0
3 years ago
Which of the following earthquake waves cause the material they pass through to compress and extend?
GarryVolchara [31]

Answer:

I think its A

Explanation:

4 0
3 years ago
Other questions:
  • Which organization has encourage free trade , increased economic interdependence, and lessened travel restrictions between Europ
    11·1 answer
  • How is geologic time measured, and what role do fossils play in dating geological events?
    11·1 answer
  • The point farthest north on the globe is the
    5·1 answer
  • What is sinking of rock layers
    8·2 answers
  • The geographical study of an area on the Earth at either the local, regional, or global scale is which of the four traditions of
    9·1 answer
  • 3. If you could choose to live in a fully free market system or fully command system, which would you choose and why?
    5·2 answers
  • Large animals, including dairy, beef, sheep, goats and swine, are the _________ of animal agriculture.
    8·1 answer
  • According to the chart above, in which location(s) do at least half of all people practice Islam? A. Zimbabwe only B. Nigeria an
    14·1 answer
  • Maps are especially useful for showing aspects of the world that cannot be seen directly. These include​
    13·1 answer
  • Define economic globalization.
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!