1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ElenaW [278]
3 years ago
6

Compare and contrast the structure and function of a compound light microscope and a scanning electron microscope. Be sure to di

scuss the structure and function of each as well as the function and usefulness of each when examining a specimen. (5 points)
Biology
1 answer:
Kaylis [27]3 years ago
8 0
Both the compound light microscope and the scanning electron microscope are devices used for visualizing structures too small to see them with the eye. But, they differ in many ways. Some of them are:

* → The light microscope is compact, handy, and simple to use.
  → The electron microscope is large, complicated, and requires technical skills.

* → The light microscope can be used for observation of both live and dead specimens.
   → The electron microscope can be used for observation of only dead specimens.

* → The light microscope uses light rays for illumination of the specimens.
  → The electron microscope uses electron beams to view specimens.

* → The light microscope has a magnification of up to 1,500 times.
  → The electron microscope has a magnification<span> of up to 1,000,000 times.

* </span>→ The light microscope has lenses made of glass.
<span>  → The electron microscope has lenses made of electromagnets.</span>
You might be interested in
Please I need help with this
barxatty [35]
TAAGCCGATAAATGCTAACGGTA
6 0
3 years ago
The researchers' experimental hypothesis was that changes in actin and myosin overlap would alter the number of myosin cross- br
muminat

Answer:

The researchers' experimental hypothesis was that changes in actin and myosin overlap would alter the number of myosin cross- bridges that could form within a sarcomere, and specifically that (Primer Section Key Terms O)

A. Increases in overlap favor more cross-bridges to form, increasing muscle force. muscle force. effect on muscle force. fiber) lengths.

Explanation:

Physiologists Alfred Gordon and Fred Julian and Andew Huxley investigated on the strianed muscle´s contraction properties, to demonstrate the way the muscle lenght is affected by changes in overlap between myocin and actin causing the number of cross-bridges increase , increasing muscle´s force as well.

No cross-bridge disruption is caused, nor litlle differences or minimal overlap so B, C and D options are not correct.

6 0
3 years ago
Compared to other methods of plant reproduction, sexual _______ ensures the highest levels of genetic diversity.
aleksandrvk [35]

Answer:

reproduction? not entirely sure what the question is asking for, but i think its reproduction.

Explanation:

8 0
3 years ago
"Scientists will often grow bacteria in prepared petri dishes. In some experiments, the petri dish will also contain paper disks
astra-53 [7]
Since I can't physically insert the appropriate heading, with units, I'll make the data table below by using the information given. 

Disk-----------Measurement of ZOI (mm)   also acceptable is ZOI (mm) 

A--------------13 ( +/- 2 mm) 

B--------------8

C-------------0

D-------------9 
4 0
3 years ago
The mass of a gold bar changes based on its location because of gravitational pull. True or false?
IrinaK [193]
False. Mass doesn't change in relation to something's location, only weight does.
3 0
3 years ago
Other questions:
  • How can you explain that the fact that fish, penguins, and dolphins all have the same basic shape?
    10·1 answer
  • If an enzyme has specific pH requirement, it will have a ____ slope. In contrast, an enzyme that can function in a range of pH v
    6·1 answer
  • Where is DNA located in prokaryotic cells?
    15·2 answers
  • The correct sequential path of a normal action potential in the heart is:
    6·1 answer
  • During DNA replication, TTAGC becomes ATAGC. This is an example of _____. deletion insertion substitution copying
    11·1 answer
  • How was the theory of the sun being made of coal determined to be false​
    12·1 answer
  • Jordan is making a model of a cell. Where should he place all of the cell's organelles?
    5·2 answers
  • 50 POINTS Plz helps
    11·1 answer
  • Easter Island is described as having a mild climate and fertile soil, which should be favorable for a diversity of organisms. Wh
    6·1 answer
  • Which set of facts is true for the lymphatic system?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!