1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sweet [91]
3 years ago
10

Cardiac muscle causes movement in the

Biology
1 answer:
kykrilka [37]3 years ago
6 0

a

Answer:

bone is the everything of movement

You might be interested in
What function does a flagellum have in a cell
Mars2501 [29]

Explanation:

Flagellum, plural flagella, hairlike structure that acts primarily as an organelle of locomotion in the cells of many living organisms. Flagella, characteristic of the protozoan group Mastigophora, also occur on the gametes of algae, fungi, mosses, slime molds, and animals.

Flagellum Definition

A flagellum is a microscopic hair-like organelle used by cells and microorganisms for movement. The word flagellum in Latin means whip, just like the whipping motion flagella (plural) often use for locomotion. Specialized flagella in some organisms are also used as sensory organelles that can detect changes in temperature and pH.

3 0
3 years ago
What is the fitness of an organism?
Airida [17]

Answer:

Also called Darwinian fitness, means the ability to survive to reproductive age find a mate, and produce offspring. Basically the more offspring an organism produces during its lifetime the greater its biological fitness.

Explanation:

3 0
3 years ago
Name the two main types of fermentation. what is the difference?
kirill [66]
Lactic acid fermentation and alcoholic fermentation
8 0
3 years ago
Which illness is most closely associated with time-temperature abused rice or other starchy foods?
pav-90 [236]
The answer is <span>Bacillus cereus

It is a bacteria responsible for some foodborne illnesses that can be found on rice products, potatoes, and pasta. This can be prevented through time and temperature control. The effect on a person having this kind of bacteria is nausea and diarrhea. 

One solution to prevent this is to give the right temperature through right cooling so germs cannot multiply. </span>
3 0
3 years ago
What is the purpose of chloroplasts?
katrin2010 [14]

Answer:

Chloroplasts are the food producers of the cell. They are only found in plant cells and some protists. Animal cells do not have chloroplasts. Every green plant you see is working to convert the energy of the sun into sugars. Plants are the basis of all life on Earth. They create sugars, and the byproduct of that process is the oxygen that we breathe. That process happens in the chloroplast. Mitochondria work in the opposite direction and break down the sugars and nutrients that the cell receives.

Explanation:

7 0
3 years ago
Read 2 more answers
Other questions:
  • What best declscribes the scientific method
    12·1 answer
  • dune grasses help hold the sand of the sand dunes in place. the grasses can survive in high winds and flooring. what feature of
    5·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • A heterozygous blue-nose pit bull breeds with another blue nosed pit bull. Their
    12·1 answer
  • Which process does not require the presence of a physical substance in order to transfer heat?
    9·1 answer
  • Volcanoes form most commonly in regions where one tectonic plate plunges beneath another tectonic plate. How does this process
    8·2 answers
  • Someone pls help. IT WOULD BE MUCH APPRECIATED.​
    8·1 answer
  • BEST ANSWER GETS BRAINLYEST
    8·1 answer
  • Describe and draw the prokaryotic and eukaryotic cells. What are the main similarities and differences?
    10·1 answer
  • Activation of a g protein in response to hormone binding requires binding of _____ to the _____ subunit.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!