1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lapatulllka [165]
3 years ago
14

Which process is represented

Biology
1 answer:
FrozenT [24]3 years ago
6 0
D.) Insertion is correct answer .....
You might be interested in
How does atp get converted from food molecules to protein?
nignag [31]
<span>Light energy has to be converted into chemical energy in ATP molecules. Plants change light into sugar molecules and both plants and animals change sugar into ATP molecules, which allows for our survival</span>
3 0
3 years ago
Drag each tile to the correct location on the chart. What are the pros and cons of sexual and asexual reproduction?
levacccp [35]

Answer:

Sexual reproduction:

Pros: leads to greater genetic variation.

Cons: requires more time and energy.

Asexual reproduction:

Pros: Does not require finding a mate.

Cons: Produce less genetic variation.

Explanation:

Sexual reproduction is a type of reproduction in higher organisms, in which new individuals are formed by combining genetic information from two different types (sexes) of individuals.

Advantage: Sexual reproduction leads to higher genetic variation due to recombination between genetic material of female and male gamete during meiosis.

Disadvantage: Sexual reproduction is a time and energy consuming process as it needs interaction between mates and organisms which are produced sexually require more time for development.

Asexual reproduction involves formation of new organisms from a single parent organism without gamete fusion.

Advantage: Asexual reproduction requires less time and energy as it does not require finding a mate.

Disadvantage: Asexual reproduction produces less genetic variations as it involves only parent organisms (no mixing of genetic information) and the only source of variations are random mutations.

7 0
3 years ago
Read 2 more answers
sequence 1 has a blank muation original: ATCGCCGGAATAGGCATCAGCAGT SEQUENCE 1: ATCGCCCGAATAGGCATCAGGAGT
Nonamiya [84]

Answer:

interesting

Explanation:

I love this, good job. Have a great day :))

4 0
3 years ago
You are observing proteins in a lab for an experiment. During transport, they have started to unwind and lose their shape.You no
Illusion [34]

The level of the structure is the proteins in the secondary.

<h3>What is the structure of secondary?</h3>
  • A polypeptide chain's adjacent amino acid residues are arranged in regular patterns in space, known as secondary structure. It is kept in place by hydrogen bonds between the amide hydrogens and the peptide backbone's carbonyl oxygens. Helixes and structures are the two main secondary structures.
  • Local regions of proteins can be organized into one of three three-dimensional configurations: alpha helices (-helix), beta sheets (-strand), or omega loops. The alpha helix is the most prevalent secondary protein shape because it is stable and low-energy.
  • The interaction of amino acids with every backbone NH hydrogen bound with the backbone C=O group of the corresponding amino acid residue in the polypeptide chain results in the- helix formation. The- helix motif is particularly prevalent in transmembrane regions of proteins that traverse the lipid bilayer.

You are observing proteins in a lab for an experiment. During transport, they have started to unwind and lose their shape.

The level of the structure is the proteins in the secondary.

To learn more about the secondary structure of a protein, refer to:

brainly.com/question/4684763

#SPJ9

5 0
1 year ago
What structure surrounds the cell and regulates materials they enter and leave the cell
adelina 88 [10]

Answer:

The Cell Membrane

5 0
3 years ago
Read 2 more answers
Other questions:
  • explain what typically marks the beginning and end of any division of time on the geologic time scale?
    7·1 answer
  • In a car accident, a person sustained major trauma to his brain and the spinal cord region of his neck. damage, in this case, wa
    15·1 answer
  • Iaia is the notation used to describe one possible genotype. how many blood type genotypes are possible?
    12·1 answer
  • The atomic number of an element is equal to its number of which subatomic particle
    13·1 answer
  • Round seeds and yellow seed color are dominate to wrinkled seeds and green seed color. what is the probability of having offspri
    9·1 answer
  • Why do X-linked traits appear more often in males
    8·1 answer
  • Devise a serial dilution scheme to prepare 1/20, 1/40, and 1/80 dilutions of a disinfectant
    12·1 answer
  • What is the role of DNA in controlling cellular activity? *
    6·1 answer
  • Interpret the Photosynti
    6·1 answer
  • What are the two that identify something has matter.​
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!