1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
andreyandreev [35.5K]
3 years ago
6

Which of the following correctly lists the images above in the correct order of ecological succession?

Biology
1 answer:
cluponka [151]3 years ago
4 0
1, 4, 3, 2 this is a bruh moment
You might be interested in
Cancer cells are rogue cells. List and explain 3 mutations that allow cancer cells to occur:
LuckyWell [14K]
Cancer is unchecked cell growth. Mutations in genes can cause cancer by accelerating cell division rates or inhibiting normal controls on the system, such as cell cycle arrest or programmed cell death. As a mass of cancerous cells grows, it can develop into a tumor
4 0
3 years ago
Why do doctors advise patients who are taking antibiotics to eat yogurt?
strojnjashka [21]
It helps prevent diarihea, which can be a side effect of taking the antibiotic  
6 0
4 years ago
During what process are chromosomes visible?
Nostrana [21]

Answer:

Prophase

Explanation:

4 0
3 years ago
Based on the composition of phloem tissue, it is most likely used by the plant for
Anettt [7]

Hey there!

The correct answer is that it is used for the transportation of the food and nutrients for the plant.

Hope this helped and have a great day (:



5 0
4 years ago
Read 2 more answers
Organisms that can't make their own food are know as (blank) and may be (blank) eating autotrophs (blank) eating other heterotro
77julia77 [94]

Answer:

organisms that can't make their own food are known as heterotrophs

8 0
3 years ago
Other questions:
  • You get home from school and grab a bag of potato chips before settling onto the couch to binge watch your newest Netflix series
    12·1 answer
  • The different phases of the moon refers to?​
    10·1 answer
  • A scientific theory can never be disproven true or false?
    11·2 answers
  • The compound light microscope is most useful for viewing
    12·2 answers
  • Two students set up the following apparatus in a lab: a pipette was filled with a mixture of yeast and apple juice and inverted
    15·2 answers
  • List the five conditions that can disturb genetic equilibrium in a population open study
    5·1 answer
  • 5’ATGCCCGGGTGTCGTAGTTGA3’<br><br> Complete the complementary sequence for the template strand.
    10·1 answer
  • What is the code for RNA
    15·1 answer
  • How is PVR (pulmonary vascular resistance) determined?
    6·1 answer
  • Which of the following is not a type of scientific model?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!