1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
laila [671]
3 years ago
9

What were most likely the first life-forms on Earth?

Biology
1 answer:
spin [16.1K]3 years ago
8 0

a would be the answer because protista were the first to be on earth and they had eye spots which could they could barely see out of and then their eyes evolved along with their body and everything but the answer was a

You might be interested in
When a cell copies its DNA (replication), the original DNA ladder is broken apart and new nucleotides are added to the center. T
VladimirAG [237]

1. TTGCATGCTAGCTACGTGTACGTACCGATGCG

2. GGGCCCATACGTACATGCATGCAGCATATAGC

3. GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

You should double check those to make sure I didn't make any mistakes. Hope this helps!

5 0
3 years ago
You are a molecule of carbon. Choose a starting
jeka94

Answer:

Explanation:point in the carbon cycle and describe the proces

you would go through to move through the entire

cycle.

8 0
3 years ago
LOTS OF POINTS!?!?!Where does the CO2 in the atmosphere come from?
allochka39001 [22]

Answer:

Carbon dioxide is added to the atmosphere naturally when organisms respire or decompose (decay), carbonate rocks are weathered, forest fires occur, and volcanoes erupt. Carbon dioxide is also added to the atmosphere through human activities, such as the burning of fossil fuels and forests and the production of cement.

Explanation:

6 0
3 years ago
Read 2 more answers
DNA replicates by breaking the bonds between its two strands, after which each strand?
salantis [7]

Answer:

i think its B

Explanation:

good luck and may the Lord bless you

5 0
3 years ago
Make a concept map that shows how photosynthesis and cellular respiration are related
lara31 [8.8K]
In plants, photosynthesis, occurring in chloroplasts, is an anabolic (bond-building) process whereby CO2 and H2O combine with the use of light (photon) energy. This yields O2 and sugar (i.e. glucose). This occurs in 2 phases: light-dependent and dark (Calvin cycle) reactions, which both continually recycle ADP/ATP and NADP/NADPH.
The catabolic (bond-breaking) process in plants is cellular respiration, in which glucose is broken down with O2 by glycolysis (cytoplasm only) and mitochondrial reactions (Krebs cycle and E.T.C.) to yield CO2 and H2O. These reactions recycle ADP/ATP and NAD/NADH. The CO2 and water produced by cellular respiration feed into the photosynthetic processes, and in turn, the O2 and glucose resulting from photosynthesis supply the respiratory reactions.
8 0
3 years ago
Other questions:
  • Which is true about enzymes? Question 20 options: They act on nonspecific, randomly chosen substrates. After a reaction, they ca
    14·1 answer
  • Which biome is characterized by a layer of permafrost?
    10·2 answers
  • You are a prestigious scientist working in a lab whose most recent project includes the creation of a series of drugs that will
    6·1 answer
  • Please help I only have 12 minutes left and only got like 7 questions done
    14·2 answers
  • La mitocondria.<br> . La célula<br> . Los virusç<br> Las bacterias<br> cual es el mas grande?
    13·1 answer
  • What one of the following historical figures is best known for establishing the first modern taxonomic system?
    9·1 answer
  • How are cellular respiration and photosynthesis mutually dependent
    9·1 answer
  • 6. In the gene pair Tt, the symbol T represent
    11·1 answer
  • Meaning of <br> biology and living things
    8·2 answers
  • True or False? : To measure the liquid in a graduated cylinder, you should read the top of the meniscus.
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!