1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sergey [27]
4 years ago
9

If a cell is in a hypertonic solution, which statement is true about water movement and the cell?

Biology
1 answer:
Solnce55 [7]4 years ago
4 0
More water leaves the cell than enters the cell. Since it is a hypertonic solution, the surrounding medium has lesser concentration of water than the cell
You might be interested in
Organ systems of the human body interact to maintain a balanced internal environment. As blood flows through certain organs of t
Ksivusya [100]

The organ system interacts with each other to maintain the normal functioning of the body. The composition of blood changes due to this interaction. The change is the blood going out from the lungs is deoxygenated and the one coming to the lungs is oxygenated.

<h3>What is the interaction of the respiratory and circulatory systems?</h3>

The respiratory system involves inhalation of oxygen and using this to release energy and exhalation of carbon dioxide.

The circulatory system is comprised of the heart and blood vessels. The heart pumps blood to different body organs through these blood vessels.

The transfer of oxygen is done with the help of blood. During this transfer, the composition of blood changes from being oxygenated means having oxygen to deoxygenated means having carbon dioxide.

Thus, in this way, the interaction changes the composition of blood.

For more details regarding blood, visit:

brainly.com/question/14781793

#SPJ1

6 0
2 years ago
molecules are attracted to one another by van der waals forces. how do van der waals forces compare with ionic and covalent bond
vitfil [10]
<h2>Answer:</h2>
  1. Ionic bond: It is the bond  formed by the complete transfer of electron from one atom to an other atom.
  2. Covalent bond: It is the bond formed by the mutual sharing of the electrons.
  3. Van der waal: These are weak interactions between one molecules with other polar or non polar molecules to hold to each other by weak force of attraction.
<h2>Explanation:</h2>
  • <u>Similarities between van der waal, ionic bonds and covalent bonds:</u> All of them are a type of inter-molecular forces, in which ionic bonds are stronger than covalent bond and van der walls forces. And covalent bonds are stronger than van der wall forces.
  • <u>Difference between van der waal and ionic bonds:</u> Ionic bonds are formed by complete transfer of electrons from one atom to an other atom. Covalent bond are formed by sharing of electrons while in van der waal, there is a slight attraction when oppositely charged molecules come close to each others.

Result: Van der wall forces are weakest among ionic and covalent bonds.

7 0
4 years ago
How does your dna relate to your physical characteristics such as eye color, skin color or the ability to roll your tongue??
Alborosie
The DNA has a special formula in it. it collects 23 chromosome from each parent that decide your trates. A way you can figure it out is by using the punnet square to figure out the outcome
3 0
3 years ago
Which is a molecule found in the body?<br> O urethra<br> O nutrients<br> O atoms<br> O water
Ulleksa [173]

Answer:

Water is the correct answer

4 0
3 years ago
Read 2 more answers
Is glycogen a protein based
fredd [130]

Glycogen Pathway: Glycogen from the liver and muscles, hydrolyzed into glucose-1-phosphate, together with fats and proteins, can feed into the catabolic pathways for carbohydrates. Glycogen, a polymer of glucose, is an energy-storage molecule in animals.

4 0
3 years ago
Read 2 more answers
Other questions:
  • Michelle is observing a sand sample under a microscope when she finds many perforated shelled organisms. Further testing reveals
    15·1 answer
  • how might your body be affected if a certain gland made too much releasing hormone that stimulates the thyroid?
    11·1 answer
  • What type of tissue comprises the bulk of the myocardium
    13·1 answer
  • Which process is a form of mechanical weathering apex
    6·2 answers
  • Which is considered a modern space exploration project rather than a historical or future project
    12·1 answer
  • Sublimation occurs when a solid changes directly to a gas without an intermediate liquid stage. True or false. I say true.
    8·1 answer
  • Which optical phenomena are formed by water droplets?
    10·1 answer
  • Explain the differences between DNA and RNA.
    14·2 answers
  • TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA
    12·1 answer
  • The algae is what in the food chain?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!