1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dybincka [34]
3 years ago
10

G a a t t c given the dna sequence shown here, what would be the sequence of the complementary mrna strand

Biology
1 answer:
nikitadnepr [17]3 years ago
8 0
In mrna adenine pairs with uracil (which replaces thymine) and guanine and cytosine pair up soo the complementary mrna strand would be cuuaag

You might be interested in
Help i cant think please i will give branliest
Paul [167]

Answer:

A

Explanation:It boils down to a and b. A single molecule of DNA is wrong. So it's a,

8 0
3 years ago
Older sedimentary rocks are usually found above younger ones. True False
kipiarov [429]
True in most cases unless they erode then the younger ones will be on top
3 0
3 years ago
Do you think acid rain is harmful
insens350 [35]
Acid rain can be very harmful, mildly harmful, or not harmful at all. It mainly depends on the density of the rain, and how bad the current air pollution in the area is. Also, it depends on how often the area gets acid rain. The first few times an area gets acid rain, it's nearly harmless. Then, the next few it can be very dangerous, but eventually gets weaker over time. More air polluted areas are more likely to get much more harmful acid rain.
Summary: Acid rain is usually mildly harmful, mostly only harmful to infrastructures.<span />
6 0
3 years ago
How many words are you responsible for this week?
arsen [322]

Answer:

how are we supposed to know how many we read today?

Explanation:

because not many people count how many words they have each week.

6 0
3 years ago
The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
liubo4ka [24]

The mRNA generated below was produced in the  <em><u>nucleus </u></em>of the cell.

Messenger RNA or mRNA is a type of RNA that is an essential component of protein synthesis or gene expression. It is synthesized using the template that is the nucleotide sequence of DNA.

  • The synthesis of the mRNA s called transcription
  • The nucleus is the location of the production of mRNA in eukaryotic cells from linear DNA strands.
  • It requires nucleotide triphosphates as substrates
  • catalyzed by the enzyme RNA polymerase II.

Thus, the process of making mRNA from DNA is called transcription, and it occurs in the nucleus.

Learn more about transcription:

brainly.com/question/11430054

8 0
2 years ago
Other questions:
  • The two basic kinds of nucleic acids are
    9·1 answer
  • If you are exposed to the noise of a jack hammer in your work, you are particularly susceptible to a __________ hearing loss. co
    8·1 answer
  • As materials move higher to lower concentration what is occurring
    9·1 answer
  • What is the best natural defense against erosion?
    7·2 answers
  • After our solar system began to form, dust and gas combined into small bodies that formed the planets. What are these small bodi
    10·2 answers
  • Which of the following statements is NOT true of protists? Protists can be single-celled or multicellular. Protists can be proka
    10·2 answers
  • Which life-form existed on Earth for the shortest period of time?
    12·2 answers
  • Carbon naturally moves through ecosystems. however, human activities over time have been impacting the carbon cycle and causing
    8·1 answer
  • How much of the outer crust of earth is
    15·1 answer
  • A<br> F<br> B<br> B<br> G<br> I<br> С<br> 1<br> J<br> D<br> K
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!