1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Rudiy27
3 years ago
7

What happens to glucose inside a cell during cellular respiration

Biology
1 answer:
Tju [1.3M]3 years ago
3 0
Glucose turns into ATP or ENERGY during the process of cellular respiration ..
<span>The glucose is broken down into 2 molecules of pyruvate, which are two smaller molecules. A net yeild of 2 ATP and 2 NADH result. Each pyruvate is connected to a coenzyme. The resulting molecule is called Acetyl CoA. That reaction also gives off 2 molecules of C02. The Acetyl CoA enters the Krebs Cycle, from which (through a series of steps), 2 more ATP, 6 NADH, 2 FADH2, and 6 CO2 are formed. The 6 NADH and FADH2 (which are coenzymes) move on to the electron transfer chain. Here, they give up their H+ and electrons to the chain. The electrons reduced the proteins on the chain, allowing H+ from outside the cell to be brought in. Bringing this H+ into the cell builds up the concentration. When the concentration gets high enough, the H+ wants to go back out of the cell. The only way to do this is through the ATP synthase. When is passes through this, the synthase combines an ADP with an inorganic phosphate, forming ATP. The typical yeild is 32 ATP from this, giving a total of 36 when you add in the ATP from glycolysis and the Krebs cycle.</span>
You might be interested in
A student conducted an experiment to test whether talking to plants would help them grow faster. The student talk to one group o
stepladder [879]
The point of the experiment has been foiled by the choice to hand water one group and use sprinklers on the other. Whether talking to the plant or not did anything can't be proven because of this. If the student were to try to publish this experiment and the outcomes. Critics would be able to use the unequal treatment in water supply as a reason to discredit his/her experiment and dismiss the claims. When performing an experiment like this it is very important to treat each side as equal as possible.
7 0
3 years ago
Read 2 more answers
The difference in the concentration of dissolved particles from one location to another is called a..,
Tema [17]

Answer:

<h2>Concentration Gradient </h2>

<h3>Hope it helps you </h3>

3 0
2 years ago
How might the study of meteorites help astronomers determine the origin of meteoroids?
olganol [36]

Answer:

Through the study of meteorites, their chemical composition of silicates—material made of silicon and oxygen. Others contain metal—nickel and iron. Knowing what the meteorite was composed of lets you know where it came from. Chondrites are composed of hardened lava - this is occurred at the beginning of the solar system (4.5 mya). Carbonaceous chondrites contain carbon and water which formed away from the sun.

Explanation:

4 0
3 years ago
Which statement is true about precipitation in biomes around the world.
kolezko [41]

Answer:

Coniferous forest biome has more precipitation to the Deciduous forest biome.

7 0
3 years ago
Read 2 more answers
PLEEASEEE IT IS URGENT I NEED THE ANSWER NOW!
torisob [31]

Answer:

A.  a cell process that releases energy from food

Explanation:

8 0
3 years ago
Read 2 more answers
Other questions:
  • What are the two gases that animals exchange with their environment?
    13·1 answer
  • Which is a function of the collecting ducts? which is a function of the collecting ducts? absorb electrolytes actively and water
    10·1 answer
  • What is the function of the organelle labeled number 9 in the image above?
    9·1 answer
  • Proteins help the body build new tissue, repair damage cells, and produce energy.
    15·1 answer
  • Produces H+ ions when added to water<br><br> A) Base<br> B) Ion <br> C) Acid
    14·2 answers
  • Which best summarizes the findings of Avery? A. Traits cannot be inherited. B.Some traits are recessive. C. Humans reproduce sex
    5·2 answers
  • Drag each label to the correct location on the chart.
    13·2 answers
  • I need help with this can anyone help​
    11·2 answers
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • The phylum Nematoda includes the flatworms.<br> a. true<br> b. false
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!