1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Daniel [21]
3 years ago
10

Which compound is a metabolic intermediate of the light-independent reactions in photosynthesis?

Biology
2 answers:
Evgesh-ka [11]3 years ago
7 0
Carbon dioxide is the compound in photosynthesis, I'm pretty sure
mario62 [17]3 years ago
5 0

the correct answer will be

3-PGA or letter B.

x)

You might be interested in
Explain how asexual reproduction is different from sexual reproduction
Nata [24]

Explanation:

asexual only needs one parent and serial needs 2 parents

asexaul animals reproduce via mitosis and sexual animals via mieosis

8 0
2 years ago
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
2 years ago
Consider three different species of wild cats. Populations of species A are spread evenly across Africa, species B is scattered
kvasek [131]

Answer:

a is DA answer

Explanation:

8 0
3 years ago
The arctic hare on the left and the jack rabbit on the right are adapted to
Zielflug [23.3K]

Answer:

B. Release body heat

Explanation:

Jackrabbits live in deserts, and therefore must release excess body heat through the surface area of their ears to avoid quickly overheating and dying.

4 0
3 years ago
Read 2 more answers
Why didn't darwin use mendel's results when formulating his theory of evolution by natural selection?
Naily [24]

Answer;

Mendel's work was not well known until many years after Darwin published his theory of evolution

Explanation;

-Mendel's work was ignored because it was not widely distributed, and he didn't make an effort to promote himself. In actual fact, the reasons are more complex.

-Gregor Mendel had the answer to Darwin's problem. Traits were not blended, but inherited whole. And according to Mendel's laws of inheritance, a trait that might disappear in one generation might reappear in the following generation. Modern Neo-Darwinism combines both Darwin's and Mendel's work.

3 0
3 years ago
Other questions:
  • In an experiment, a geneticist crosses two pure-breeding pea plants, one with round seeds and the other with wrinkled seeds. If
    12·1 answer
  • Bacteria and viruses can multiply on living and nonliving surfaces. question 71 options:
    10·1 answer
  • What are some limiting factors?
    9·1 answer
  • A taxonomic category between kingdom and class is _____. group species phylum order
    9·2 answers
  • What is erosion?
    6·1 answer
  • Which organelle would not be found in a prokaryotic cell? A) nucleus b)cell membrane c)Cytoplasm d)Genetic material​
    12·1 answer
  • What is produced from the electron transport chain?
    14·2 answers
  • Which of the following is commonly grown as a green manure crop?
    15·1 answer
  • What is the mass of the green cone on gizmos
    6·1 answer
  • Global warming would be an example of ___ factor in a firm's external environment.
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!