the complementary strand would be 5' TACGGGCCCACAGCATCAACT3'
the complementary strand would be this sinceyoujust switch the letter in the strand out for its pair when looking for a comlementry strand
so for reference heres a little cheat guide
Adenine=Thymine
Thymine=Adenine
Guanine=Cytosine
Cytosine=Guanine
diamond=carbon and its comp.
water=oxygen and its comp.
carbohydrates=carbon and its comp.
ozone=oxygen and its comp.
ethane=carbon and its comp.
Hope my answer helps! :)
it becomes how much of the plant is composed of non-cellular material, like wood. Trees are usually between 60 and 80% water, bushier, less woody plants and water plants can be up to 95% water. Finally, as pointed out, humans are animals, so go with the animal stats for humans. 68% water about average.
Hey there!
Your answer is:
There are alternate versions of a gene.
Hope this helps!
Have a great day! (:
