1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ilya [14]
2 years ago
15

E. do the sd, cv, and beta produce the same risk ranking

Biology
1 answer:
aksik [14]2 years ago
6 0
<span>Standard deviation measures the total amount of risk. It is a summation of both systematic and unsystematic risk. CV is a much more better parameter than SD. It is obtained by dividing SD with mean. Beta is a parameter for systematic risk which measures the sensitivity towards market.</span>
You might be interested in
Monosaccharides can be classified based on the number of carbons they contain and the type of group attached to the molecule. Se
jok3333 [9.3K]
<h2>Monosaccharides</h2>

Explanation:

Monosaccharides are the simplest form of sugars found in innumerable common food items such as honey, cane sugar, fruits

Monosaccharides are divided into two groups depending on the presence of functional groups,if aldehyde group is present then it is known aldoses and if ketone group is present then it is known as ketoses

On the basis of carbon atoms they can be classified as: triose(3),tetrose(4),pentose(5),hexose(6) and so on

a. erythrose : tetrose ketose-It is not correctly paired because erythrose is a tetrose monosaccharide which has one aldehyde group hence is an aldose

b. dihydroxyacetone : triose ketose-It is correctly paired;it is an aldose-ketose pair

c. erythrulose : tetrose aldose-It is not correctly paired because erythrulose is a tetrose monosaccharide having ketone as functional group hence is a ketose

d. fructose : hexose ketose-it is correctly paired;It is an anomer because in D-fructose carbonyl group is at C-2 hence C-2 is the anomeric carbon

e. ribose : hexose aldose-it is not correctly paired because ribose is an aldo pentose not hexose;ribose is an aldo-ketose pair

f. glyceraldehyde : triose aldose-it is correctly paired;an aldo group

8 0
2 years ago
Which of the following best describes the role of bacterial decomposition in the ocean?
Darya [45]

They are pervasive and play many different roles in the marine environment, from being the base of the food chain, controlling much of the flow of marine energy and nutrients, and being essential to the ocean's health.

6 0
3 years ago
True or False: As the environment becomes less polluted, the number of light colored moths is able to decrease.
kotykmax [81]
This is True because the Eco-System is aways changing since pollution is killing birds animals and other insects.
5 0
3 years ago
Explain the process of diffusion using a diagram
vesna_86 [32]
Process resulting from random motion of molecules by which there is a net flow of matter from a region of high concentration to a region of low concentration.
6 0
3 years ago
describe the effect of magnesium deficiency on the transport of sucrose out of the leaves and the sucrose concentration out of t
weeeeeb [17]

Answer:

The impact of diminishing the convergence of magnesium salt on the development of S.polyrhiza is because the low mg accessibility keeps an eye on troublesome sucrose exportation, making leaves hold sucrose three to multiple times more than the leaves of plants that get Mg in satisfactory inventory, showing that the inadequacy of this supplement causes extreme hindrance of sucrose transport.

Explanation:

6 0
3 years ago
Other questions:
  • What happens to the sodium and potassium ions when the neurons are stimulated? How does their concentration inside and outside t
    8·2 answers
  • I WILL MARK YOU THE BRAINLIEST GIVE ME THE RIGHT AWSER
    8·2 answers
  • What is resistance?
    7·2 answers
  • What cells are used during crossing over
    13·1 answer
  • In a population with 2 alleles for a particular locus (D and d), the frequency of the D allele is 0.75.
    6·1 answer
  • Travis is warming up before basketball practice. Identify the activity that would provide the best dynamic stretch to prepare hi
    14·2 answers
  • Read the following statements that describe childbirth. What is the correct order in which they occur?
    8·2 answers
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • A man who is color blind married a woman with normal color vision whose father was colorblind, what is the probability of a chil
    14·1 answer
  • The administration of prepared antibodies, such as those in breast milk, is an example of _____ immunity.
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!