1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Marysya12 [62]
3 years ago
8

During sporulation, offspring develop from tiny structures called ______.

Biology
2 answers:
AleksAgata [21]3 years ago
8 0

Answer:

spores

Explanation:

Karolina [17]3 years ago
3 0

Answer:

Spores.

Explanation:

Sporulation is a type of asexual reproduction which occurs in organisms such as fungi, bacteria. In sporulation, specialized cells transformed into a hard resistant resting structure to overcome unfavourable condition. On the return of favourable conditions spores germinate to form new offspring. Sporulation is very common in fungi.  

You might be interested in
In which abdominal organ is water extracted from digested food
dmitriy555 [2]
In small intestine water is extracted from digested food.
8 0
3 years ago
Snake venom contains a mixture of enzymes, which include phospholipase that break down cell membranes, proteinases that destroy
Alik [6]

Answer:

The correct answer is - Venom enzyme inhibitors.

Explanation:

The snake venoms are the complex mixtures of phospholipase A2s, disintegrins, serine proteases, C-lectins, and metalloproteases, and others. The snake venom phospholipase A2s (svPLA2s) enzymes found in most of the families of venomous snakes that cause anticoagulant effects, cardiotoxicity, neurotoxicity, and cytotoxicity, and other effects.

In antivenom, there are Venom enzyme inhibitors other than antibodies that help in neutralizing these enzymes by weakening or inhibiting these toxic actions.

3 0
2 years ago
How do you clear your notifications.
netineya [11]
U just check a few of them and pretty much close the app then they should be cleared :)
8 0
3 years ago
The "photo-" part of the word photosynthesis refers to the _____, whereas "-synthesis" refers to ____
Debora [2.8K]

Answer:

1. Light

2. production of large component from smaller components

Explanation:

In the given question, the meaning of the word Photo is light and the synthesis refers to the production and combining these words form photosynthesis. The literal meaning of photosynthesis will be the production of some compounds in the presence of light.

The word photosynthesis is used by the biologists to refer to a process taking place in the green plants which involve the light for the synthesis of energy-providing molecule glucose.

Thus, 1. The light and production of the large components are correct.

5 0
3 years ago
What is the relationship between animals and plants? (Using the photo) <br> PLS HELPP
Alona [7]
Plants feed/provide energy to animals And animals create carbon dioxide for plants
4 0
3 years ago
Other questions:
  • 1. According to the central dogma, what is the relationship among DNA, RNA, and proteins?
    9·1 answer
  • Which biome has multistory communities?
    14·1 answer
  • Please help me i’m confused
    6·1 answer
  • Which of the following are NOT energy reserves?
    13·1 answer
  • What is a gene??????????????!!!!!!
    12·2 answers
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • What would be a growth factor for a population of deer?
    8·1 answer
  • Macromolecules inside of foods can be large polymers or small monomers
    9·1 answer
  • 20 POINTS!! PLS HELP for Social Studies:
    5·1 answer
  • knockout of the circadian clock protein per1 exacerbates hypertension and increases kidney injury in dahl salt-sensitive rats
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!