1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mel-nik [20]
3 years ago
12

(BRAINLY FOR CORRECT ANSWER, PLEASE HELP)

Biology
1 answer:
AnnZ [28]3 years ago
5 0
I think its the first one
You might be interested in
.
murzikaleks [220]

Answer:it can be as a result of chromosomal mutation or gene mutation or variation as result of crossing over

8 0
3 years ago
Although generally not considered to be alive,a _______ is studied alongside other microbes such as bacteria
Luda [366]

The answer is virus it is considered to be alive

5 0
3 years ago
Explain how natural resources influence relationships among other nations
FinnZ [79.3K]

Answer:

Every nation has its own natural resourse that has abundant and theres other that lack so the countries will trade they abundant for the ones they dont have.

Explanation:

3 0
3 years ago
Which of the following scenarios is representative of how agricultural practices can affect the environment?
Citrus2011 [14]
<span>The correct answer to the question, 'which of the following scenarios is representative of how agricultural practice can affect the environment' is A. Option A is chosen because it is the only option that refer to another environment which is different from that of the farm. When fertilizers are washed to nearby ponds as a result of erosion, it causes a lot of negative changes in the pond. For instance, the chemicals in the fertilizer can be poisonous to some of the smaller organisms in the pond, this will result in the death of these organisms. Fertilizer run off can also cause excessive growth of plants such as algae in the pond. This may block out the light necessary for the survival of the organisms in the ponds and may also reduce the amount of oxygen available to the organisms living in the pond.</span>
6 0
3 years ago
Read 2 more answers
Explain the role convection plays in the rock cycle
Romashka-Z-Leto [24]

Like most Earth materials, rocks are created and destroyed in cycles. The rock cycle is a model that describes the formation, breakdown, and reformation of a rock as a result of sedimentary, igneous, and metamorphic processes. All rocks are made up of minerals. A mineral is defined as a naturally occurring, crystalline solid of definite chemical composition and a characteristic crystal structure. A rock is any naturally formed, nonliving, firm, and coherent aggregate mass of solid matter that constitutes part of a planet.

4 0
4 years ago
Other questions:
  • Based on the phylogenetic tree below, which groups of plants evolved most recently?
    15·1 answer
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • The analogy of ATP molecules and rechargeable batteries is fitting because ______. Select one: a. all batteries are rechargeable
    13·1 answer
  • Induced pluripotent stem cells are ?
    11·2 answers
  • Based on the desert food chain provided, which change in the ecosystem would have the greatest negative effect?
    9·2 answers
  • Refer to this portion of a dichotomous key to answer the question.
    13·2 answers
  • Please help w/ this question
    15·1 answer
  • What are the three tasks that DNA must be able to perform in all organisms?
    12·1 answer
  • What is the purpose of a
    9·1 answer
  • What are the characteristics of life on earth?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!